Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) Rno-Mir-154-P36_3p (mature (guide)) URS00002915C8_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAUGUUGCUCGGUGAACCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-409
  2. Cavia porcellus (domestic guinea pig) cpo-miR-409-3p
  3. Cervus elaphus (red deer) cel-miR-409-3p
  4. Cricetulus griseus cgr-miR-409-3p
  5. Dasypus novemcinctus dno-miR-409-3p
  6. Equus caballus eca-miR-409-3p
  7. Homo sapiens hsa-miR-409-3p
  8. Macaca mulatta mml-miR-409-3p
  9. Mus musculus (house mouse) mmu-miR-409-3p
  10. Oryctolagus cuniculus (rabbit) ocu-miR-409-3p
  11. Pan paniscus ppa-miR-409
  12. Pan troglodytes (chimpanzee) ptr-miR-409
  13. Papio hamadryas pha-miR-409
  14. Pongo pygmaeus ppy-miR-409-3p
  15. Pteropus alecto pal-miR-409-3p
  16. Sus scrofa ssc-mir12
  17. Tupaia chinensis tch-miR-409-3p