Cricetulus griseus (Chinese hamster) cgr-miR-409-3p URS00002915C8_10029

• 22 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 17 other species
• 20 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

GAAUGUUGCUCGGUGAACCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

1. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-409
2. Cavia porcellus (domestic guinea pig) cpo-miR-409-3p
3. Cervus elaphus (red deer) cel-miR-409-3p
4. Dasypus novemcinctus dno-miR-409-3p
5. Equus caballus eca-miR-409-3p
6. Homo sapiens hsa-miR-409-3p
7. Macaca mulatta mml-miR-409-3p
8. Mus musculus (house mouse) mmu-miR-409-3p
9. Oryctolagus cuniculus (rabbit) ocu-miR-409-3p
10. Pan paniscus ppa-miR-409
11. Pan troglodytes (chimpanzee) ptr-miR-409
12. Papio hamadryas pha-miR-409
13. Pongo pygmaeus ppy-miR-409-3p
14. Pteropus alecto pal-miR-409-3p
15. Rattus norvegicus Rno-Mir-154-P36_3p (mature (guide))
16. Sus scrofa ssc-mir12
17. Tupaia chinensis tch-miR-409-3p

Publications Download

• FASTA
• JSON