Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
tRNA (76-MER) from Mitsuaria sp. 67 (PDB 4WT8, chain D4) secondary structure diagram

tRNA (76-MER) from Mitsuaria sp. 67 (PDB 4WT8, chain D4) URS00002905B5_308052

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGGGGUGGAGCAGCCUGGUAGCUCGUCGGGCUCAUAACCCGAAGGUCGUCGGUUCAAAUCCGGCCCCCGCAACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 53 other species

  1. Atlantibacter subterraneus tRNA-Met
  2. Citrobacter europaeus tRNA-Met
  3. Citrobacter farmeri tRNA-Met
  4. Citrobacter freundii tRNA-Met
  5. Citrobacter portucalensis tRNA-Met
  6. Citrobacter werkmanii tRNA-Met
  7. Citrobacter youngae tRNA-Met
  8. Escherichia coli K-12 Deacylated tRNAi(Met) from Escherichia coli K-12 (PDB 6XZ7, chain f)
  9. Enterobacter asburiae tRNA-Met
  10. Enterobacter cloacae tRNA-Met
  11. Enterobacter hormaechei subsp. oharae tRNA-Met
  12. Enterobacter hormaechei subsp. steigerwaltii tRNA-Met
  13. Enterobacter hormaechei subsp. xiangfangensis tRNA-Met
  14. Enterobacter hormaechei tRNA-Met
  15. Enterobacter kobei tRNA-Met
  16. Enterobacter ludwigii tRNA-Met
  17. Enterobacter mori tRNA-Met
  18. Enterobacter roggenkampii tRNA-Met
  19. Enterobacter sp. HPCN14 tRNA-Met
  20. Enterobacter mori Enterobacter tabaci tRNA-Met
  21. Escherichia coli FRIK1999 partial tRNA-Met
  22. Escherichia sp. HH26CH tRNA-Met
  23. Escherichia coli BW25113 Initiator tRNA from Escherichia coli BW25113 (PDB 8AM9, chain Y)
  24. Klebsiella aerogenes tRNA-Met
  25. Klebsiella michiganensis tRNA-Met
  26. Klebsiella pneumoniae subsp. pneumoniae tRNA-Met
  27. Klebsiella pneumoniae tRNA-Met
  28. Klebsiella quasipneumoniae tRNA-Met
  29. Klebsiella sp. KG9 tRNA-Met
  30. Klebsiella sp. MBT K-1 tRNA-Met
  31. Klebsiella variicola tRNA-Met
  32. Pectobacterium atrosepticum tRNA-Met
  33. Rahnella aquatilis tRNA-Met
  34. Rahnella inusitata tRNA-Met
  35. Rahnella woolbedingensis tRNA-Met
  36. Salmonella enterica subsp. enterica serovar Dublin tRNA-Met
  37. Salmonella enterica subsp. enterica serovar Enteritidis tRNA-Met
  38. Salmonella enterica subsp. enterica serovar Infantis tRNA-Met
  39. Salmonella enterica subsp. enterica serovar Kentucky tRNA-Met
  40. Salmonella enterica subsp. enterica serovar Lubbock tRNA-Met
  41. Salmonella enterica subsp. enterica serovar Mbandaka tRNA-Met
  42. Salmonella enterica subsp. enterica serovar Montevideo tRNA-Met
  43. Salmonella enterica subsp. enterica serovar Newport tRNA-Met
  44. Salmonella enterica subsp. enterica serovar Reading tRNA-Met
  45. Salmonella enterica subsp. enterica serovar Saintpaul tRNA-Met
  46. Salmonella enterica subsp. enterica serovar Typhimurium (Salmonella typhimurium) tRNA-Met
  47. Salmonella enterica subsp. enterica serovar Typhi tRNA-Met
  48. Salmonella enterica tRNA-Met
  49. Shigella boydii tRNA-Met
  50. Shigella flexneri tRNA-Met
  51. Shigella sonnei tRNA-Met
  52. Escherichia coli tRNA(fMet) from Escherichia coli (PDB 8QK7, chain 5)
  53. Yersinia sp. 2105 StPb PI tRNA-Met
Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications