Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Salmonella enterica subsp. enterica serovar Mbandaka tRNA-Met secondary structure diagram

Salmonella enterica subsp. enterica serovar Mbandaka tRNA-Met URS00002905B5_192954

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCGGGGUGGAGCAGCCUGGUAGCUCGUCGGGCUCAUAACCCGAAGGUCGUCGGUUCAAAUCCGGCCCCCGCAACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Atlantibacter subterraneus tRNA-Met
  2. Citrobacter europaeus tRNA-Met
  3. Citrobacter farmeri tRNA-Met
  4. Citrobacter freundii tRNA-Met
  5. Citrobacter portucalensis tRNA-Met
  6. Citrobacter werkmanii tRNA-Met
  7. Citrobacter youngae tRNA-Met
  8. Escherichia coli K-12 Deacylated tRNAi(Met) from Escherichia coli K-12 (PDB 6XZ7, chain f)
  9. Enterobacter asburiae tRNA-Met
  10. Enterobacter cloacae tRNA-Met
  11. Enterobacter hormaechei subsp. oharae tRNA-Met
  12. Enterobacter hormaechei subsp. steigerwaltii tRNA-Met
  13. Enterobacter hormaechei subsp. xiangfangensis tRNA-Met
  14. Enterobacter hormaechei tRNA-Met
  15. Enterobacter kobei tRNA-Met
  16. Enterobacter ludwigii tRNA-Met
  17. Enterobacter mori tRNA-Met
  18. Enterobacter roggenkampii tRNA-Met
  19. Enterobacter sp. HPCN14 tRNA-Met
  20. Enterobacter mori Enterobacter tabaci tRNA-Met
  21. Escherichia coli FRIK1999 partial tRNA-Met
  22. Escherichia sp. HH26CH tRNA-Met
  23. Escherichia coli BW25113 Initiator tRNA from Escherichia coli BW25113 (PDB 8AM9, chain Y)
  24. Klebsiella aerogenes tRNA-Met
  25. Klebsiella michiganensis tRNA-Met
  26. Klebsiella pneumoniae subsp. pneumoniae tRNA-Met
  27. Klebsiella pneumoniae tRNA-Met
  28. Klebsiella quasipneumoniae tRNA-Met
  29. Klebsiella sp. KG9 tRNA-Met
  30. Klebsiella sp. MBT K-1 tRNA-Met
  31. Klebsiella variicola tRNA-Met
  32. Pectobacterium atrosepticum tRNA-Met
  33. Rahnella aquatilis tRNA-Met
  34. Rahnella inusitata tRNA-Met
  35. Rahnella woolbedingensis tRNA-Met
  36. Salmonella enterica subsp. enterica serovar Dublin tRNA-Met
  37. Salmonella enterica subsp. enterica serovar Enteritidis tRNA-Met
  38. Salmonella enterica subsp. enterica serovar Infantis tRNA-Met
  39. Salmonella enterica subsp. enterica serovar Kentucky tRNA-Met
  40. Salmonella enterica subsp. enterica serovar Lubbock tRNA-Met
  41. Salmonella enterica subsp. enterica serovar Montevideo tRNA-Met
  42. Salmonella enterica subsp. enterica serovar Newport tRNA-Met
  43. Salmonella enterica subsp. enterica serovar Reading tRNA-Met
  44. Salmonella enterica subsp. enterica serovar Saintpaul tRNA-Met
  45. Salmonella enterica subsp. enterica serovar Typhimurium (Salmonella typhimurium) tRNA-Met
  46. Salmonella enterica subsp. enterica serovar Typhi tRNA-Met
  47. Salmonella enterica tRNA-Met
  48. Salmonella sp. A1484 tRNA-Met
  49. Salmonella sp. C3004 tRNA-Met
  50. Salmonella sp. C3006 tRNA-Met
  51. Salmonella sp. C3008 tRNA-Met
  52. Salmonella sp. C3009 tRNA-Met
  53. Salmonella sp. C3022 tRNA-Met
  54. Salmonella sp. C3024 tRNA-Met
  55. Salmonella sp. C3026 tRNA-Met
  56. Salmonella sp. C3030 tRNA-Met
  57. Salmonella sp. C3076 tRNA-Met
  58. Salmonella sp. C3078 tRNA-Met
  59. Salmonella sp. C3083 tRNA-Met
  60. Salmonella sp. C3089 tRNA-Met
  61. Salmonella sp. C3103 tRNA-Met
  62. Salmonella sp. C3106 tRNA-Met
  63. Salmonella sp. C3107 tRNA-Met
  64. Salmonella sp. C3121 tRNA-Met
  65. Salmonella sp. C3125 tRNA-Met
  66. Salmonella sp. NW643 tRNA-Met
  67. Salmonella sp. NW847 tRNA-Met
  68. Salmonella sp. NW873 tRNA-Met
  69. Shigella boydii tRNA-Met
  70. Shigella flexneri tRNA-Met
  71. Shigella sonnei tRNA-Met
  72. synthetic construct other sequence
  73. Mitsuaria sp. 67 tRNA (76-MER) from Mitsuaria sp. 67 (PDB 4WT8, chain D4)
  74. Escherichia coli tRNA(fMet) from Escherichia coli (PDB 8QK7, chain 5)
  75. Brassica oleracea var. botrytis tRNA from Brassica oleracea var. botrytis (PDB 9EVS, chain 5)
  76. Yersinia sp. 2105 StPb PI tRNA-Met
Relationships

Molecular Relationships

2D structure

Loading 2D structure...