Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-598-3p URS000028FD1A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-598: Several miRNAs, including hsa-miR-484, hsa-mir-598, hsa-miR-7, hsa-miR-195, and hsa-miR-211, have been associated with autism [PMC3581547]. However, miRNAs such as hsa-mir-598 have also been identified as candidate biomarkers in different fluids and cancers [PMC10002054][PMC8894079]. In tongue cancer samples, miRNAs such as hsa-mir-598 were found to be downregulated [PMC7942015]. Additionally, miRNAs like hsa-mir-598 have been implicated in cancer progression and have prognostic and predictive roles [PMC4335255]. In the context of lymphomas, a minimal set of miRNAs including hsa-mir-598 was found to distinguish different subtypes of lymphomas [PMC7229769]. Furthermore, in the context of tuberculosis (TB), miRNAs like hsa-mir-598 were found to be differentially expressed between active TB and healthy controls [PMC4460131].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACGUCAUCGUUGUCAUCGUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

  1. Cavia porcellus (domestic guinea pig) Cpo-Mir-598_3p (mature (guide))
  2. Equus caballus eca-miR-598
  3. Gorilla gorilla gorilla ggo-miR-598 (MIR598)
  4. Gorilla gorilla (western gorilla) ggo-miR-598
  5. Macaca mulatta mml-miR-598-3p
  6. Pan troglodytes (chimpanzee) ptr-miR-598
  7. Pongo pygmaeus ppy-miR-598
Publications