Gorilla gorilla gorilla ggo-miR-598 (MIR598)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla ggo-miR-598 (MIR598) URS000028FD1A_9595

22 nucleotides
1 database (RefSeq)
Found in 7 other species
11 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UACGUCAUCGUUGUCAUCGUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Cavia porcellus (domestic guinea pig) Cpo-Mir-598_3p (mature (guide))
Equus caballus eca-miR-598
Gorilla gorilla (western gorilla) ggo-miR-598
Homo sapiens hsa-miR-598-3p
Macaca mulatta mml-miR-598-3p
Pan troglodytes (chimpanzee) ptr-miR-598
Pongo pygmaeus ppy-miR-598

Publications