Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Aspartate tRNA (tRNA-Asp), predicted by tRNAscan-SE analysis secondary structure diagram

Saccharomyces cerevisiae S288C Aspartate tRNA (tRNA-Asp), predicted by tRNAscan-SE analysis URS000027E1E5_559292

Automated summary: This tRNA sequence is 72 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 5 databases (Rfam, GtRNAdb, SGD, IntAct, ENA). Described in 76 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Saccharomyces cerevisiae S288C Aspartate tRNA (tRNA-Asp), predicted by tRNAscan-SE analysis sequence is a product of tRNA-Asp-GTC-1-6, tRNA-Asp-GTC-1-11, tRNA-Asp-GTC-1-4, tRNA-Asp-GTC-1-8, tRNA-Asp-GTC-1-14, tRNA-Asp-GTC-1-9, tRNA-Asp-GTC-1-12, tRNA-Asp-GTC-1-2, tRNA-Asp-GTC-1-7, tRNA-Asp-GTC-1-13, tRNA-Asp-GTC-1-5, tRNA-Asp-GTC-1-1, tRNA-Asp-GTC-1-10, tRNA-Asp-GTC-1-15, tRNA-Asp-GTC-1-3 genes. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 11

According to IntAct, Saccharomyces cerevisiae S288C Aspartate tRNA (tRNA-Asp), predicted by tRNAscan-SE analysis interacts with:

Interaction id Participant Synonyms
EBI-12561664 P04802 APS APS1 Aspartyl-tRNA synthetase D6VXY6 DPS1 EBI-18655 L1295 P04802 YLL018C sydc_yeast
EBI-12561366 P04802 APS APS1 Aspartyl-tRNA synthetase D6VXY6 DPS1 EBI-18655 L1295 P04802 YLL018C sydc_yeast
EBI-12517716 P38205 D6VPX6 EBI-11933 Multisite-specific tRNA:m5C-methyltransferase NCL1 P38205 TRM4 YBL024W YBL0437 ncl1_yeast tRNA (cytosine-5-)-methyltransferase NCL1 tRNA methyltransferase 4
EBI-12516174 P38205 D6VPX6 EBI-11933 Multisite-specific tRNA:m5C-methyltransferase NCL1 P38205 TRM4 YBL024W YBL0437 ncl1_yeast tRNA (cytosine-5-)-methyltransferase NCL1 tRNA methyltransferase 4
EBI-12520069 P48567 D6W0Q1 EBI-14291 N0480 P48567 PUS4 YNL292W pus4_yeast tRNA pseudouridine(55) synthase tRNA pseudouridylate synthase 4 tRNA-uridine isomerase 4
EBI-11701540 Q08647 D6W2U5 EBI-29265 O5254 PUS7 Q08647 RNA pseudouridylate synthase 7 RNA-uridine isomerase 7 YOR243C pus7_yeast tRNA pseudouridine(13) synthase
EBI-11701557 Q08647 D6W2U5 EBI-29265 O5254 PUS7 Q08647 RNA pseudouridylate synthase 7 RNA-uridine isomerase 7 YOR243C pus7_yeast tRNA pseudouridine(13) synthase
EBI-11701686 Q12069 D2743 D6VRV8 EBI-22107 PUS9 Q12069 Q6B2P8 YDL036C pus9_yeast tRNA pseudouridine synthase 9 tRNA pseudouridylate synthase 9 tRNA-uridine isomerase 9
EBI-11705149 Q12211 D6W3F8 EBI-14272 PUS1 Q12211 YPL212C pus1_yeast tRNA pseudouridylate synthase 1 tRNA-uridine isomerase 1
EBI-11701904 Q12362 D6W201 EBI-15158 PUS8 Q12362 RIB2 YOL066C rib2_yeast
EBI-11701766 Q12362 D6W201 EBI-15158 PUS8 Q12362 RIB2 YOL066C rib2_yeast

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCCGUGAUAGUUUAAUGGUCAGAAUGGGCGCUUGUCGCGUGCCAGAUCGGGGUUCAAUUCCCCGUCGCGGAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 158 other species

    1. Blumeria graminis f. sp. tritici 94202 tRNA-Asp (GTC) (tRNA-Asp-GTC-3-1)
    2. Thermus thermophilus E-SITE TRNA OF 70S RIBOSOME from Thermus thermophilus (PDB 486D, chain E)
    3. Kazachstania barnettii transfer RNA-Asp(GTC)
    4. Kazachstania exigua partial transfer RNA
    5. Kazachstania saulgeensis tRNA
    6. Kazachstania servazzii partial transfer RNA
    7. Naumovozyma dairenensis CBS 421 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 11)
    8. Rothia sp. Olga tRNA-Asp
    9. Saccharomyces arboricola H-6 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 15)
    10. Saccharomyces boulardii (nom. inval.) tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 17)
    11. Saccharomyces cerevisiae AWRI796 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 15)
    12. Saccharomyces cerevisiae (baker's yeast) tD(GTC)JL1 - systematic name
    13. Saccharomyces cerevisiae CBS 7960 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 14)
    14. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 14)
    15. Saccharomyces cerevisiae CLIB215 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 16)
    16. Saccharomyces cerevisiae CLIB324 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 17)
    17. Saccharomyces cerevisiae CLIB382 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 9)
    18. Saccharomyces cerevisiae EC1118 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 10, tRNA-Asp-GTC-3 1 to 4)
    19. Saccharomyces cerevisiae EC9-8 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 15)
    20. Saccharomyces cerevisiae FL100 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 12)
    21. Saccharomyces cerevisiae FostersB tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 13)
    22. Saccharomyces cerevisiae FostersO tRNA
    23. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 16)
    24. Saccharomyces cerevisiae Lalvin QA23 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 5, tRNA-Asp-GTC-3 1 to 9)
    25. Saccharomyces cerevisiae P283 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 15)
    26. Saccharomyces cerevisiae P301 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 13)
    27. Saccharomyces cerevisiae PE-2 tRNA-Asp
    28. Saccharomyces cerevisiae PW5 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 6)
    29. Saccharomyces cerevisiae R008 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 16)
    30. Saccharomyces cerevisiae R103 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 15)
    31. Saccharomyces cerevisiae RM11-1a tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 16)
    32. Saccharomyces cerevisiae Sigma1278b tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 15)
    33. Saccharomyces cerevisiae T73 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 11)
    34. Saccharomyces cerevisiae T7 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 16)
    35. Saccharomyces cerevisiae UC5 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 8)
    36. Saccharomyces cerevisiae UFMG A-905 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 19)
    37. Saccharomyces cerevisiae Vin13 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 14)
    38. Saccharomyces cerevisiae VL3 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 15)
    39. Saccharomyces cerevisiae W303 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 15)
    40. Saccharomyces cerevisiae Y10 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 8)
    41. Saccharomyces cerevisiae YJM1078 tRNA-Asp
    42. Saccharomyces cerevisiae YJM1083 tRNA-Asp
    43. Saccharomyces cerevisiae YJM1129 tRNA-Asp
    44. Saccharomyces cerevisiae YJM1133 tRNA-Asp
    45. Saccharomyces cerevisiae YJM1190 tRNA-Asp
    46. Saccharomyces cerevisiae YJM1199 tRNA-Asp
    47. Saccharomyces cerevisiae YJM1202 tRNA-Asp
    48. Saccharomyces cerevisiae YJM1208 tRNA-Asp
    49. Saccharomyces cerevisiae YJM1242 tRNA-Asp
    50. Saccharomyces cerevisiae YJM1244 tRNA-Asp
    51. Saccharomyces cerevisiae YJM1248 tRNA-Asp
    52. Saccharomyces cerevisiae YJM1250 tRNA-Asp
    53. Saccharomyces cerevisiae YJM1252 tRNA-Asp
    54. Saccharomyces cerevisiae YJM1273 tRNA-Asp
    55. Saccharomyces cerevisiae YJM1304 tRNA-Asp
    56. Saccharomyces cerevisiae YJM1307 tRNA-Asp
    57. Saccharomyces cerevisiae YJM1311 tRNA-Asp
    58. Saccharomyces cerevisiae YJM1326 tRNA-Asp
    59. Saccharomyces cerevisiae YJM1332 tRNA-Asp
    60. Saccharomyces cerevisiae YJM1336 tRNA-Asp
    61. Saccharomyces cerevisiae YJM1338 tRNA-Asp
    62. Saccharomyces cerevisiae YJM1341 tRNA-Asp
    63. Saccharomyces cerevisiae YJM1342 tRNA-Asp
    64. Saccharomyces cerevisiae YJM1355 tRNA-Asp
    65. Saccharomyces cerevisiae YJM1356 tRNA-Asp
    66. Saccharomyces cerevisiae YJM1381 tRNA-Asp
    67. Saccharomyces cerevisiae YJM1383 tRNA-Asp
    68. Saccharomyces cerevisiae YJM1385 tRNA-Asp
    69. Saccharomyces cerevisiae YJM1386 tRNA-Asp
    70. Saccharomyces cerevisiae YJM1387 tRNA-Asp
    71. Saccharomyces cerevisiae YJM1388 tRNA-Asp
    72. Saccharomyces cerevisiae YJM1389 tRNA-Asp
    73. Saccharomyces cerevisiae YJM1399 tRNA-Asp
    74. Saccharomyces cerevisiae YJM1400 tRNA-Asp
    75. Saccharomyces cerevisiae YJM1401 tRNA-Asp
    76. Saccharomyces cerevisiae YJM1402 tRNA-Asp
    77. Saccharomyces cerevisiae YJM1415 tRNA-Asp
    78. Saccharomyces cerevisiae YJM1417 tRNA-Asp
    79. Saccharomyces cerevisiae YJM1418 tRNA-Asp
    80. Saccharomyces cerevisiae YJM1419 tRNA-Asp
    81. Saccharomyces cerevisiae YJM1433 tRNA-Asp
    82. Saccharomyces cerevisiae YJM1434 tRNA-Asp
    83. Saccharomyces cerevisiae YJM1439 tRNA-Asp
    84. Saccharomyces cerevisiae YJM1443 tRNA-Asp
    85. Saccharomyces cerevisiae YJM1444 tRNA-Asp
    86. Saccharomyces cerevisiae YJM1447 tRNA-Asp
    87. Saccharomyces cerevisiae YJM1450 tRNA-Asp
    88. Saccharomyces cerevisiae YJM1460 tRNA-Asp
    89. Saccharomyces cerevisiae YJM1463 tRNA-Asp
    90. Saccharomyces cerevisiae YJM1477 tRNA-Asp
    91. Saccharomyces cerevisiae YJM1478 tRNA-Asp
    92. Saccharomyces cerevisiae YJM1479 tRNA-Asp
    93. Saccharomyces cerevisiae YJM1526 tRNA-Asp
    94. Saccharomyces cerevisiae YJM1527 tRNA-Asp
    95. Saccharomyces cerevisiae YJM1549 tRNA-Asp
    96. Saccharomyces cerevisiae YJM1573 tRNA-Asp
    97. Saccharomyces cerevisiae YJM1574 tRNA-Asp
    98. Saccharomyces cerevisiae YJM1592 tRNA-Asp
    99. Saccharomyces cerevisiae YJM1615 tRNA-Asp
    100. Saccharomyces cerevisiae YJM189 tRNA-Asp
    101. Saccharomyces cerevisiae YJM193 tRNA-Asp
    102. Saccharomyces cerevisiae YJM195 tRNA-Asp
    103. Saccharomyces cerevisiae YJM244 tRNA-Asp
    104. Saccharomyces cerevisiae YJM248 tRNA-Asp
    105. Saccharomyces cerevisiae YJM269 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 16)
    106. Saccharomyces cerevisiae YJM270 tRNA-Asp
    107. Saccharomyces cerevisiae YJM271 tRNA-Asp
    108. Saccharomyces cerevisiae YJM320 tRNA-Asp
    109. Saccharomyces cerevisiae YJM326 tRNA-Asp
    110. Saccharomyces cerevisiae YJM428 tRNA-Asp
    111. Saccharomyces cerevisiae YJM450 tRNA-Asp
    112. Saccharomyces cerevisiae YJM451 tRNA-Asp
    113. Saccharomyces cerevisiae YJM453 tRNA-Asp
    114. Saccharomyces cerevisiae YJM456 tRNA-Asp
    115. Saccharomyces cerevisiae YJM470 tRNA-Asp
    116. Saccharomyces cerevisiae YJM541 tRNA-Asp
    117. Saccharomyces cerevisiae YJM554 tRNA-Asp
    118. Saccharomyces cerevisiae YJM555 tRNA-Asp
    119. Saccharomyces cerevisiae YJM627 tRNA-Asp
    120. Saccharomyces cerevisiae YJM681 tRNA-Asp
    121. Saccharomyces cerevisiae YJM682 tRNA-Asp
    122. Saccharomyces cerevisiae YJM683 tRNA-Asp
    123. Saccharomyces cerevisiae YJM689 tRNA-Asp
    124. Saccharomyces cerevisiae YJM693 tRNA-Asp
    125. Saccharomyces cerevisiae YJM969 tRNA-Asp
    126. Saccharomyces cerevisiae YJM972 tRNA-Asp
    127. Saccharomyces cerevisiae YJM975 tRNA-Asp
    128. Saccharomyces cerevisiae YJM978 tRNA-Asp
    129. Saccharomyces cerevisiae YJM981 tRNA-Asp
    130. Saccharomyces cerevisiae YJM984 tRNA-Asp
    131. Saccharomyces cerevisiae YJM987 tRNA-Asp
    132. Saccharomyces cerevisiae YJM990 tRNA-Asp
    133. Saccharomyces cerevisiae YJM993 tRNA-Asp
    134. Saccharomyces cerevisiae YJM996 tRNA-Asp
    135. Saccharomyces cerevisiae YJSH1 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 15)
    136. Saccharomyces eubayanus tRNA-Asp
    137. Saccharomyces kudriavzevii IFO 1802 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 14)
    138. Saccharomyces pastorianus tRNA-Asp
    139. Zygosaccharomyces bailii ISA1307 transfer RNA-Asp(GTC)
    140. Zygosaccharomyces bailii transfer RNA-Asp(GTC)
    141. Zygosaccharomyces mellis tRNA-Asp
    142. Zygosaccharomyces parabailii tRNA-Asp
    143. Zygosaccharomyces rouxii CBS 732 tRNA
    144. Zygosaccharomyces rouxii tRNA-Asp (GTC) (tRNA-Asp-GTC-2-1)
    2D structure New