Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM1199 tRNA-Asp secondary structure diagram

Saccharomyces cerevisiae YJM1199 tRNA-Asp URS000027E1E5_1294335

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCGUGAUAGUUUAAUGGUCAGAAUGGGCGCUUGUCGCGUGCCAGAUCGGGGUUCAAUUCCCCGUCGCGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 152 other species

  1. Blumeria graminis f. sp. tritici 94202 tRNA-Asp (GTC) (tRNA-Asp-GTC-3-1)
  2. Thermus thermophilus E-SITE TRNA OF 70S RIBOSOME from Thermus thermophilus (PDB 486D, chain E)
  3. Fusarium falciforme tRNA-Asp
  4. Fusarium oxysporum tRNA-Asp
  5. Kazachstania barnettii transfer RNA-Asp(GTC)
  6. Kazachstania bulderi transfer RNA-Asp(GTC)
  7. Kazachstania exigua partial transfer RNA
  8. Kazachstania saulgeensis tRNA
  9. Kazachstania servazzii partial transfer RNA
  10. Naumovozyma dairenensis CBS 421 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 11)
  11. Rothia sp. Olga tRNA-Asp
  12. Saccharomyces arboricola H-6 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 15)
  13. Saccharomyces boulardii (nom. inval.) tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 17)
  14. Saccharomyces cerevisiae AWRI796 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 15)
  15. Saccharomyces cerevisiae tRNA
  16. Saccharomyces cerevisiae CBS 7960 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 14)
  17. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 14)
  18. Saccharomyces cerevisiae CLIB215 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 16)
  19. Saccharomyces cerevisiae CLIB324 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 17)
  20. Saccharomyces cerevisiae CLIB382 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 9)
  21. Saccharomyces cerevisiae EC1118 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 10, tRNA-Asp-GTC-3 1 to 4)
  22. Saccharomyces cerevisiae EC9-8 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 15)
  23. Saccharomyces cerevisiae FL100 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 12)
  24. Saccharomyces cerevisiae FostersB tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 13)
  25. Saccharomyces cerevisiae FostersO tRNA
  26. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 16)
  27. Saccharomyces cerevisiae Lalvin QA23 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 5, tRNA-Asp-GTC-3 1 to 9)
  28. Saccharomyces cerevisiae P283 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 15)
  29. Saccharomyces cerevisiae P301 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 13)
  30. Saccharomyces cerevisiae PE-2 tRNA-Asp
  31. Saccharomyces cerevisiae PW5 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 6)
  32. Saccharomyces cerevisiae R008 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 16)
  33. Saccharomyces cerevisiae R103 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 15)
  34. Saccharomyces cerevisiae RM11-1a tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 16)
  35. Saccharomyces cerevisiae S288C tRNA-Asp
  36. Saccharomyces cerevisiae Sigma1278b tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 15)
  37. Saccharomyces cerevisiae synthetic construct tRNA-Asp
  38. Saccharomyces cerevisiae T73 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 11)
  39. Saccharomyces cerevisiae T7 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 16)
  40. Saccharomyces cerevisiae UC5 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 8)
  41. Saccharomyces cerevisiae UFMG A-905 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 19)
  42. Saccharomyces cerevisiae Vin13 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 14)
  43. Saccharomyces cerevisiae VL3 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 15)
  44. Saccharomyces cerevisiae W303 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 15)
  45. Saccharomyces cerevisiae Y10 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 8)
  46. Saccharomyces cerevisiae YJM1078 tRNA-Asp
  47. Saccharomyces cerevisiae YJM1083 tRNA-Asp
  48. Saccharomyces cerevisiae YJM1129 tRNA-Asp
  49. Saccharomyces cerevisiae YJM1133 tRNA-Asp
  50. Saccharomyces cerevisiae YJM1190 tRNA-Asp
  51. Saccharomyces cerevisiae YJM1202 tRNA-Asp
  52. Saccharomyces cerevisiae YJM1208 tRNA-Asp
  53. Saccharomyces cerevisiae YJM1242 tRNA-Asp
  54. Saccharomyces cerevisiae YJM1244 tRNA-Asp
  55. Saccharomyces cerevisiae YJM1248 tRNA-Asp
  56. Saccharomyces cerevisiae YJM1250 tRNA-Asp
  57. Saccharomyces cerevisiae YJM1252 tRNA-Asp
  58. Saccharomyces cerevisiae YJM1273 tRNA-Asp
  59. Saccharomyces cerevisiae YJM1304 tRNA-Asp
  60. Saccharomyces cerevisiae YJM1307 tRNA-Asp
  61. Saccharomyces cerevisiae YJM1311 tRNA-Asp
  62. Saccharomyces cerevisiae YJM1326 tRNA-Asp
  63. Saccharomyces cerevisiae YJM1332 tRNA-Asp
  64. Saccharomyces cerevisiae YJM1336 tRNA-Asp
  65. Saccharomyces cerevisiae YJM1338 tRNA-Asp
  66. Saccharomyces cerevisiae YJM1341 tRNA-Asp
  67. Saccharomyces cerevisiae YJM1342 tRNA-Asp
  68. Saccharomyces cerevisiae YJM1355 tRNA-Asp
  69. Saccharomyces cerevisiae YJM1356 tRNA-Asp
  70. Saccharomyces cerevisiae YJM1381 tRNA-Asp
  71. Saccharomyces cerevisiae YJM1383 tRNA-Asp
  72. Saccharomyces cerevisiae YJM1385 tRNA-Asp
  73. Saccharomyces cerevisiae YJM1386 tRNA-Asp
  74. Saccharomyces cerevisiae YJM1387 tRNA-Asp
  75. Saccharomyces cerevisiae YJM1388 tRNA-Asp
  76. Saccharomyces cerevisiae YJM1389 tRNA-Asp
  77. Saccharomyces cerevisiae YJM1399 tRNA-Asp
  78. Saccharomyces cerevisiae YJM1400 tRNA-Asp
  79. Saccharomyces cerevisiae YJM1401 tRNA-Asp
  80. Saccharomyces cerevisiae YJM1402 tRNA-Asp
  81. Saccharomyces cerevisiae YJM1415 tRNA-Asp
  82. Saccharomyces cerevisiae YJM1417 tRNA-Asp
  83. Saccharomyces cerevisiae YJM1418 tRNA-Asp
  84. Saccharomyces cerevisiae YJM1419 tRNA-Asp
  85. Saccharomyces cerevisiae YJM1433 tRNA-Asp
  86. Saccharomyces cerevisiae YJM1434 tRNA-Asp
  87. Saccharomyces cerevisiae YJM1439 tRNA-Asp
  88. Saccharomyces cerevisiae YJM1443 tRNA-Asp
  89. Saccharomyces cerevisiae YJM1444 tRNA-Asp
  90. Saccharomyces cerevisiae YJM1447 tRNA-Asp
  91. Saccharomyces cerevisiae YJM1450 tRNA-Asp
  92. Saccharomyces cerevisiae YJM1460 tRNA-Asp
  93. Saccharomyces cerevisiae YJM1463 tRNA-Asp
  94. Saccharomyces cerevisiae YJM1477 tRNA-Asp
  95. Saccharomyces cerevisiae YJM1478 tRNA-Asp
  96. Saccharomyces cerevisiae YJM1479 tRNA-Asp
  97. Saccharomyces cerevisiae YJM1526 tRNA-Asp
  98. Saccharomyces cerevisiae YJM1527 tRNA-Asp
  99. Saccharomyces cerevisiae YJM1549 tRNA-Asp
  100. Saccharomyces cerevisiae YJM1573 tRNA-Asp
  101. Saccharomyces cerevisiae YJM1574 tRNA-Asp
  102. Saccharomyces cerevisiae YJM1592 tRNA-Asp
  103. Saccharomyces cerevisiae YJM1615 tRNA-Asp
  104. Saccharomyces cerevisiae YJM189 tRNA-Asp
  105. Saccharomyces cerevisiae YJM193 tRNA-Asp
  106. Saccharomyces cerevisiae YJM195 tRNA-Asp
  107. Saccharomyces cerevisiae YJM244 tRNA-Asp
  108. Saccharomyces cerevisiae YJM248 tRNA-Asp
  109. Saccharomyces cerevisiae YJM269 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 16)
  110. Saccharomyces cerevisiae YJM270 tRNA-Asp
  111. Saccharomyces cerevisiae YJM271 tRNA-Asp
  112. Saccharomyces cerevisiae YJM320 tRNA-Asp
  113. Saccharomyces cerevisiae YJM326 tRNA-Asp
  114. Saccharomyces cerevisiae YJM428 tRNA-Asp
  115. Saccharomyces cerevisiae YJM450 tRNA-Asp
  116. Saccharomyces cerevisiae YJM451 tRNA-Asp
  117. Saccharomyces cerevisiae YJM453 tRNA-Asp
  118. Saccharomyces cerevisiae YJM456 tRNA-Asp
  119. Saccharomyces cerevisiae YJM470 tRNA-Asp
  120. Saccharomyces cerevisiae YJM541 tRNA-Asp
  121. Saccharomyces cerevisiae YJM554 tRNA-Asp
  122. Saccharomyces cerevisiae YJM555 tRNA-Asp
  123. Saccharomyces cerevisiae YJM627 tRNA-Asp
  124. Saccharomyces cerevisiae YJM681 tRNA-Asp
  125. Saccharomyces cerevisiae YJM682 tRNA-Asp
  126. Saccharomyces cerevisiae YJM683 tRNA-Asp
  127. Saccharomyces cerevisiae YJM689 tRNA-Asp
  128. Saccharomyces cerevisiae YJM693 tRNA-Asp
  129. Saccharomyces cerevisiae YJM969 tRNA-Asp
  130. Saccharomyces cerevisiae YJM972 tRNA-Asp
  131. Saccharomyces cerevisiae YJM975 tRNA-Asp
  132. Saccharomyces cerevisiae YJM978 tRNA-Asp
  133. Saccharomyces cerevisiae YJM981 tRNA-Asp
  134. Saccharomyces cerevisiae YJM984 tRNA-Asp
  135. Saccharomyces cerevisiae YJM987 tRNA-Asp
  136. Saccharomyces cerevisiae YJM990 tRNA-Asp
  137. Saccharomyces cerevisiae YJM993 tRNA-Asp
  138. Saccharomyces cerevisiae YJM996 tRNA-Asp
  139. Saccharomyces cerevisiae YJSH1 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 15)
  140. Saccharomyces eubayanus tRNA-Asp
  141. Saccharomyces kudriavzevii IFO 1802 tRNA-Asp (GTC) (tRNA-Asp-GTC-1 1 to 14)
  142. Saccharomyces kudriavzevii ZP591 tRNA-Asp
  143. Saccharomyces mikatae IFO 1815 tRNA-Asp
  144. Saccharomyces pastorianus tRNA-Asp
  145. Saccharomyces uvarum tRNA-Asp
  146. Vector YCy2508 tRNA-Asp
  147. Zygosaccharomyces bailii ISA1307 transfer RNA-Asp(GTC)
  148. Zygosaccharomyces bailii transfer RNA-Asp(GTC)
  149. Zygosaccharomyces mellis tRNA-Asp
  150. Zygosaccharomyces parabailii tRNA-Asp
  151. Zygosaccharomyces rouxii CBS 732 tRNA
  152. Zygosaccharomyces rouxii tRNA-Asp (GTC) (tRNA-Asp-GTC-2-1)
2D structure