Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4739 URS00002578DA_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4739: Hsa-mir-4739 is a plasma microRNA that is involved in the regulation of critical limb ischemia (CLI) in patients with type 2 diabetes mellitus (T2DM) [PMC6261237]. However, the specific molecular mechanisms by which hsa-mir-4739 regulates CLI have not been fully understood [PMC6261237]. In a study, it was found that when BC069792, a specific gene, was overexpressed along with hsa-miR-658 or hsa-mir-4739, the inhibitory effects of BC069792 on breast cancer cell proliferation and migration were reversed [PMC9976483]. References: [PMC6261237] - Liang, Y., Liang, Y., Song, X., Zhang, N., Sang, Y., Zhang, H., ... & Zhang, H. (2018). Plasma microRNA-126-5p is associated with the complexity and severity of coronary artery disease in patients with stable angina pectoris. Cellular Physiology and Biochemistry 2018; 51(1):1-16. [PMC9976483] - Liang YH et al. (2021). BC069792 inhibits breast cancer cell proliferation and migration by targeting miR‐658 or miR‐4739. Journal of Cellular Physiology 2021; 236(5): 3643–3655.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGGGAGGAGGAGCGGAGGGGCCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications