Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-92b-3p URS000025576D_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (RefSeq, ENA, LncBase, miRBase, GeneCards, IntAct, MalaCards, MirGeneDB, TarBase). Described in 51 papers. Homo sapiens (human) hsa-miR-92b-3p sequence is a product of hsa-miR-92b, miR-92, miR-92b-3p, MIR92B, miR-92b, hsa-miR-92b-3p genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 16E1BP, 1700010H15RiK, 182-FIP, 18A2, 42A, 6A3-5, 82-FIP, 87U6, A4, A4-LSB.

Interactions 2

According to IntAct, Homo sapiens (human) hsa-miR-92b-3p interacts with:

IntAct ID Participant Synonyms
EBI-25469555 intact:EBI-25469542 EBI-25469542 ENST00000414822 mrna_cdkn1c
EBI-25469573 intact:EBI-25469542 EBI-25469542 ENST00000414822 mrna_cdkn1c

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAUUGCACUCGUCCCGGCCUCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 39 other species

    1. Alligator mississippiensis Ami-Mir-92-P1c_3p (mature (guide))
    2. Bos taurus (cattle) bta-miR-92b
    3. Callithrix jacchus cja-miR-92b
    4. Canis lupus familiaris cfa-miR-92b
    5. Cavia porcellus (domestic guinea pig) cpo-miR-92b-3p
    6. Cervus elaphus (red deer) cel-miR-92b
    7. Chrysemys picta bellii Cpi-Mir-92-P1c_3p (mature (guide))
    8. Chrysemys picta cpi-miR-92b-3p
    9. Cricetulus griseus (Chinese hamster) cgr-miR-92b-3p
    10. Cyprinus carpio ccr-miR-92b
    11. Danio rerio (zebrafish) dre-miR-92b-3p
    12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-92b-3p
    13. Echinops telfairi Ete-Mir-92-P1c_3p (mature (guide))
    14. Eptesicus fuscus (big brown bat) efu-miR-92b
    15. Equus caballus (horse) eca-miR-92b
    16. Gallus gallus (chicken) microRNA miR-92b
    17. Haplochromis burtoni abu-miR-92b
    18. Ictalurus punctatus (channel catfish) ipu-miR-92b
    19. Macaca mulatta (Rhesus monkey) mml-miR-92b-3p
    20. Maylandia zebra mze-miR-92b
    21. Monodelphis domestica (gray short-tailed opossum) mdo-miR-92b-3p
    22. Mus musculus mmu-miR-92b-3p
    23. Neolamprologus brichardi nbr-miR-92b
    24. Nomascus leucogenys nle-miR-92b
    25. Oreochromis niloticus oni-miR-92b
    26. Ornithorhynchus anatinus (platypus) Oan-Mir-92-P1c_3p (mature (guide))
    27. Oryctolagus cuniculus (rabbit) Ocu-Mir-92-P1c_3p (mature (guide))
    28. Pan paniscus (pygmy chimpanzee) ppa-miR-92b
    29. Pan troglodytes (chimpanzee) ptr-miR-92b
    30. Pongo pygmaeus ppy-miR-92b
    31. Pteropus alecto pal-miR-92b-3p
    32. Rattus norvegicus (Norway rat) rno-miR-92b-3p
    33. Salmo salar (Atlantic salmon) ssa-miR-92b-3p
    34. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-92-P1c_3p (mature (guide))
    35. Scyliorhinus torazame (cloudy catshark) Sto-Mir-92-P1c_3p (mature (guide))
    36. Sus scrofa (pig) ssc-miR-92b-3p
    37. Taeniopygia guttata Tgu-Mir-92-P1c_3p (mature (guide))
    38. Tor tambroides miR-92b-3p
    39. Xenopus laevis (African clawed frog) xla-miR-92b
    40. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-4946154