v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) bta-miR-92b URS000025576D_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-92b: Bta-mir-92b is a microRNA that has been examined in various studies. It has been found to target SOX4, a gene that is targeted by multiple miRNAs [PMC5908868][PMC6162677]. Bta-mir-92b has also been correlated with the expression of seven genes associated with ECM and immune system-related pathways [PMC7242321]. It belongs to the miR-25 family and is connected to blastocyst-associated miRNAs [PMC8944274]. In the context of bacterial infection, bta-mir-92b, along with bta-miR-1343-3p and bta-miR-1306, may play a role in MDMs and could be further investigated [PMC6600136]. In another study, bta-mir-92b was found to be differentially expressed after MAP infection in serum [PMC6600136]. Furthermore, bta-mir-92b was found to be upregulated in both ANCs and APCs compared to heifers [PMC6731312]. Bta-mir-92b has also been associated with trophoblastic differentiation and vascularization during placental development [PMC5662615]. Overall, these studies highlight the importance of bta-mir-92b in various biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAUUGCACUCGUCCCGGCCUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 44 other species

  1. Alligator mississippiensis (American alligator) Ami-Mir-92-P1d_3p (mature (guide))
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-92b
  3. Canis lupus familiaris cfa-miR-92b
  4. Cavia porcellus (domestic guinea pig) cpo-miR-92b-3p
  5. Cervus elaphus cel-miR-92b
  6. Chrysemys picta bellii Cpi-Mir-92-P1d_3p (mature (guide))
  7. Chrysemys picta cpi-miR-92b-3p
  8. Cricetulus griseus (Chinese hamster) cgr-miR-92b-3p
  9. Cyprinus carpio (common carp) ccr-miR-92b
  10. Danio rerio dre-miR-92b-3p
  11. Dasypus novemcinctus dno-miR-92b-3p
  12. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-92-P1d_3p (mature (guide))
  13. Eptesicus fuscus (big brown bat) efu-miR-92b
  14. Equus caballus eca-miR-92b
  15. Gallus gallus microRNA miR-92b
  16. Haplochromis burtoni abu-miR-92b
  17. Homo sapiens hsa-miR-92b-3p
  18. Ictalurus punctatus (channel catfish) ipu-miR-92b
  19. Latimeria chalumnae Lch-Mir-92-P1d_3p (mature (guide))
  20. Lepisosteus oculatus Loc-Mir-92-P1d_3p (mature (guide))
  21. Macaca mulatta mml-miR-92b-3p
  22. Maylandia zebra mze-miR-92b
  23. Microcaecilia unicolor Mun-Mir-92-P1d_3p (mature (guide))
  24. Monodelphis domestica (gray short-tailed opossum) mdo-miR-92b-3p
  25. Mus musculus (house mouse) mmu-miR-92b-3p
  26. Neolamprologus brichardi (lyretail cichlid) nbr-miR-92b
  27. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-92b
  28. Oreochromis niloticus oni-miR-92b
  29. Ornithorhynchus anatinus Oan-Mir-92-P1d_3p (mature (guide))
  30. Oryctolagus cuniculus (rabbit) Ocu-Mir-92-P1d_3p (mature (guide))
  31. Pan paniscus ppa-miR-92b
  32. Pan troglodytes (chimpanzee) ptr-miR-92b
  33. Pongo pygmaeus (Bornean orangutan) ppy-miR-92b
  34. Pteropus alecto pal-miR-92b-3p
  35. Rattus norvegicus rno-miR-92b-3p
  36. Salmo salar ssa-miR-92b-3p
  37. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-92-P1d_3p (mature (guide))
  38. Scyliorhinus torazame (cloudy catshark) Sto-Mir-92-P1d_3p (mature (guide))
  39. Sphenodon punctatus Spt-Mir-92-P1d_3p (mature (guide))
  40. Sus scrofa ssc-miR-92b-3p
  41. Taeniopygia guttata (zebra finch) Tgu-Mir-92-P1d_3p (mature (guide))
  42. Tor tambroides miR-92b-3p
  43. Xenopus laevis (African clawed frog) Xla-Mir-92-P1d1_3p (mature (guide))
  44. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-92-P1d_3p (mature (guide))
 Publications