Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C Small Nucleolar RNA secondary structure diagram

Saccharomyces cerevisiae S288C Small Nucleolar RNA URS000024F0F7_559292

Automated summary: This snoRNA sequence is 225 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 4 databases (RefSeq, IntAct, SGD, ENA). Described in 37 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (snR31, RF01257). Saccharomyces cerevisiae S288C Small Nucleolar RNA sequence is a product of SNR31 gene. Found in the Saccharomyces cerevisiae S288C reference genome.

Interactions 2

According to IntAct, Saccharomyces cerevisiae S288C Small Nucleolar RNA interacts with:

Interaction id Participant Synonyms
EBI-15095622 URS000061F377_559292 EBI-10903441 URS000061F377_559292 rrna 25s yeast
EBI-11621467 P28007 D3DL41 EBI-7321 GAR1 P28007 YHR089C gar1_yeast snoRNP protein GAR1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GAAGCAAAAUUACACCAUGAGUUCCUAUUAACGUCAGCCUCUUUUGUACUCAUAAUGUGGCUUCGGAUGUUUGAUGGGCGUUGCUUCAGUGCGUACGGCUCAUGGUAGAUUAAUUAUUAGAAAGAUGUAUCUCCAGCUGUUGAUAUUAGAGGGGGAAGCCUUUCUCUUUCACCUCGCCUUUUUAAACACCUGAUACAGUUGGUCAUGAUUCGUUCUACAUUUUAA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species

    1. Saccharomyces cerevisiae small nucleolar RNA snR31
    2. Saccharomyces cerevisiae YJM1208 SNR31
    3. Saccharomyces cerevisiae YJM1248 SNR31
    4. Saccharomyces cerevisiae YJM1386 SNR31
    5. Saccharomyces cerevisiae YJM1401 SNR31
    6. Saccharomyces cerevisiae YJM1418 SNR31
    7. Saccharomyces cerevisiae YJM1439 SNR31
    8. Saccharomyces cerevisiae YJM1443 SNR31
    9. Saccharomyces cerevisiae YJM1447 SNR31
    10. Saccharomyces cerevisiae YJM1615 SNR31
    11. Saccharomyces cerevisiae YJM195 SNR31
    12. Saccharomyces cerevisiae YJM428 SNR31
    13. Saccharomyces cerevisiae YJM627 SNR31
    2D structure New