Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM1615 SNR31 secondary structure diagram

Saccharomyces cerevisiae YJM1615 SNR31 URS000024F0F7_1294388

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAGCAAAAUUACACCAUGAGUUCCUAUUAACGUCAGCCUCUUUUGUACUCAUAAUGUGGCUUCGGAUGUUUGAUGGGCGUUGCUUCAGUGCGUACGGCUCAUGGUAGAUUAAUUAUUAGAAAGAUGUAUCUCCAGCUGUUGAUAUUAGAGGGGGAAGCCUUUCUCUUUCACCUCGCCUUUUUAAACACCUGAUACAGUUGGUCAUGAUUCGUUCUACAUUUUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Saccharomyces cerevisiae (baker's yeast) small nucleolar RNA snR31
  2. Saccharomyces cerevisiae S288C Small Nucleolar RNA
  3. Saccharomyces cerevisiae YJM1208 SNR31
  4. Saccharomyces cerevisiae YJM1248 SNR31
  5. Saccharomyces cerevisiae YJM1386 SNR31
  6. Saccharomyces cerevisiae YJM1401 SNR31
  7. Saccharomyces cerevisiae YJM1418 SNR31
  8. Saccharomyces cerevisiae YJM1439 SNR31
  9. Saccharomyces cerevisiae YJM1443 SNR31
  10. Saccharomyces cerevisiae YJM1447 SNR31
  11. Saccharomyces cerevisiae YJM195 SNR31
  12. Saccharomyces cerevisiae YJM428 SNR31
  13. Saccharomyces cerevisiae YJM627 SNR31
2D structure