v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Alligator mississippiensis tRNA-Thr (AGT) (tRNA-Thr-AGT-2-1) secondary structure diagram

Alligator mississippiensis tRNA-Thr (AGT) (tRNA-Thr-AGT-2-1) URS000023FFA7_8496

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGCGCCGUGGCUUAGCUGGUUAAAGCGCCUGUCUAGUAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGGUGCCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 57 other species

  1. Ailuropoda melanoleuca tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  2. Apaloderma vittatum tRNA
  3. Bos taurus tRNA-Thr (AGT) (tRNA-Thr-AGT-5-1)
  4. Calypte anna tRNA
  5. Camelus ferus (Wild Bactrian camel) tRNA
  6. Canis lupus familiaris tRNA-Thr (AGT) (tRNA-Thr-AGT-4-1)
  7. Carlito syrichta tRNA-Thr (AGT) (tRNA-Thr-AGT-5-1)
  8. Ceratotherium simum simum tRNA-Thr (AGT) (tRNA-Thr-AGT-6-1)
  9. Charadrius vociferus tRNA
  10. Choloepus hoffmanni tRNA-Thr (AGT) (tRNA-Thr-AGT-4-1)
  11. Colius striatus tRNA
  12. Columba livia tRNA
  13. Cricetulus griseus tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  14. Dasypus novemcinctus tRNA-Thr (AGT) (tRNA-Thr-AGT-5-1)
  15. Dipodomys ordii tRNA-Thr (AGT) (tRNA-Thr-AGT-5-1)
  16. Echinops telfairi tRNA-Thr (AGT) (tRNA-Thr-AGT-6-1)
  17. Egretta garzetta tRNA
  18. Equus caballus tRNA-Thr (AGT) (tRNA-Thr-AGT-6-1)
  19. Erinaceus europaeus tRNA-Thr (AGT) (tRNA-Thr-AGT-5-1, tRNA-Thr-AGT-5-2)
  20. Felis catus tRNA-Thr (AGT) (tRNA-Thr-AGT-4-1)
  21. Fukomys damarensis tRNA
  22. Gallus gallus tRNA-Thr (AGT) (tRNA-Thr-AGT-5-1)
  23. Geospiza fortis tRNA-Thr (AGT) (tRNA-Thr-AGT-2-1)
  24. Gorilla gorilla gorilla tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  25. Homo sapiens tRNA-Thr (anticodon AGT) 5-1 (TRT-AGT5-1)
  26. Ictidomys tridecemlineatus tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  27. Lamprotornis superbus tRNA-OTHER
  28. Loxodonta africana tRNA-Thr (AGT) (tRNA-Thr-AGT-8-1)
  29. Marmota monax (woodchuck) tRNA.Thr
  30. Meleagris gallopavo tRNA-Thr (AGT) (tRNA-Thr-AGT-2-1, tRNA-Thr-AGT-2-2)
  31. Mesitornis unicolor tRNA
  32. Mesocricetus auratus (golden hamster) tRNA
  33. Microcebus murinus tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  34. Mus musculus castaneus tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  35. Mus musculus domesticus tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  36. Mus musculus musculus tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  37. Mus musculus tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  38. Mus pahari tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  39. Mus spretus tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  40. Mustela putorius furo tRNA-Thr (AGT) (tRNA-Thr-AGT-4-1)
  41. Nomascus leucogenys tRNA-Thr (AGT) (tRNA-Thr-AGT-4-1)
  42. Ochotona princeps tRNA-Thr (AGT) (tRNA-Thr-AGT-5-1)
  43. Ophiophagus hannah tRNA
  44. Otolemur garnettii tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  45. Ovis aries tRNA-Thr (AGT) (tRNA-Thr-AGT-5-1)
  46. Pan troglodytes tRNA-Thr (AGT) (tRNA-Thr-AGT-5-1)
  47. Patagioenas fasciata monilis tRNA
  48. Dryobates pubescens tRNA
  49. Podarcis lilfordi tRNA.Thr
  50. Pongo abelii tRNA-Thr (AGT) (tRNA-Thr-AGT-5-1)
  51. Procavia capensis tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  52. Pteropus alecto tRNA
  53. Sorex araneus tRNA-Thr (AGT) (tRNA-Thr-AGT-4-1)
  54. Struthio camelus australis tRNA
  55. Sus scrofa tRNA-Thr (AGT) (tRNA-Thr-AGT-3-1)
  56. Trichechus manatus latirostris tRNA-Thr (AGT) (tRNA-Thr-AGT-5-1)
  57. Vicugna pacos tRNA-Thr (AGT) (tRNA-Thr-AGT-4-1)
 2D structure Publications