Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3175 URS00002394F5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3175: Hsa-mir-3175 is identified as one of the three significant DEmiRNAs that regulate HDAC7, along with hsa-miR-23a-3p and hsa-miR-23b-3p, and it plays a regulatory role in the progression of systemic inflammatory cardiomyopathy (SIC) by interfering with HDAC7/ACTN4 in monocytes and cardiac tissue cells [PMC9218607]. Hsa-mir-3175, along with hsa-miR-23a-3p and hsa-miR-23b-3p, is hypothesized to regulate SIC progression by influencing the inflammatory response and apoptosis through the translation of HDAC7 [PMC9218607]. Hsa-mir-3175 is a human-specific miRNA that shows a 100% sequence identity between known mature mouse, human, rat, and Chinese hamster miRNAs [PMC4139590]. It is not found in the genome of CHO-K1 (Chinese hamster ovary) cells [PMC4139590]. Hsa-mir-3175 is one of the DEmiRNAs that regulate THSD4, a down-regulated DEmRNA in prostate cancer (PCa), along with hsa-miR107 and hsa-miR484 [PMC8799076]. It has been suggested that THSD4 might be a potential regulator of PCa through its regulation by these PCa-related miRNAs [PMC8799076]. Additionally, hsa-mir-3175 can regulate various target genes associated with immune response and angiogenesis leading to placental insufficiency [PMC8779150].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGGGGAGAGAACGCAGUGACGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications