Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Macaca mulatta tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6) secondary structure diagram

Macaca mulatta tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6) URS000022DD4A_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCCCGGAUAGCUCAGUCGGUAGAGCAUCAGACUUUUAAUCUGAGGGUCCAGGGUUCAAGUCCCUGUUCGGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 162 other species

  1. Acanthisitta chloris tRNA
  2. Acinetobacter baumannii tRNA-Lys
  3. Acromyrmex echinatior (Panamanian leaf-cutter ant) tRNA-Lys
  4. Ailuropoda melanoleuca tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 5)
  5. Albula glossodonta tRNA-OTHER
  6. Albula goreensis tRNA-Lys
  7. Alligator mississippiensis tRNA-Lys (TTT) (tRNA-Lys-TTT-2 1 to 3)
  8. Alligator sinensis tRNA
  9. Alosa alosa tRNA-Lys
  10. Amazona aestiva tRNA
  11. Amblyteles armatorius (Ichneumon Wasp) misc RNA ENSAAYG00000011384.1
  12. Ameiurus melas tRNA-Lys
  13. Anguilla anguilla tRNA-Lys
  14. Anolis carolinensis tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 3)
  15. Astyanax mexicanus (Mexican tetra) tRNA
  16. Ataeniobius toweri tRNA-Lys
  17. Athalia rosae (Coleseed sawfly) misc RNA ENSAEAG00005012360.1
  18. Atta cephalotes tRNA LOC105616957-5
  19. Atta colombica tRNA
  20. Balaenoptera acutorostrata scammoni tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 3)
  21. Bos taurus tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 8)
  22. Callipepla squamata (scaled quail) tRNA
  23. Callithrix jacchus tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 5)
  24. Callorhinchus milii tRNA-Lys (TTT) (tRNA-Lys-TTT-2 1 to 7)
  25. Calypte anna (Anna's hummingbird) tRNA
  26. Camelus ferus (Wild Bactrian camel) tRNA
  27. Canis lupus familiaris tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  28. Carlito syrichta tRNA-Lys (TTT) (tRNA-Lys-TTT-2 1 to 5)
  29. Cavia porcellus tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 5)
  30. Ceratotherium simum simum tRNA-Lys (TTT) (tRNA-Lys-TTT-2 1 to 5)
  31. Chaetura pelagica (chimney swift) tRNA
  32. Characodon lateralis tRNA-Lys
  33. Chelonia mydas tRNA
  34. Chelydra serpentina tRNA-Lys
  35. Chlorocebus sabaeus tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  36. Choloepus hoffmanni tRNA-Lys (TTT) (tRNA-Lys-TTT-2 1 to 4)
  37. Chrysemys picta bellii tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 4)
  38. Colinus virginianus (northern bobwhite) tRNA
  39. Columba livia tRNA
  40. Copidosoma floridanum tRNA-Lys
  41. Cotesia glomerata (White butterfly parasite wasp) tRNA-Lys
  42. Crenichthys baileyi tRNA-Lys
  43. Cricetulus griseus tRNA-Lys (TTT) (tRNA-Lys-TTT-2 1 to 6)
  44. Cuculus canorus tRNA
  45. Cyphomyrmex costatus tRNA
  46. Dallia pectoralis tRNA-OTHER
  47. Danionella translucida tRNA-Lys
  48. Danio rerio tRNA-Lys (TTT) (tRNA-Lys-TTT-6 1 to 128)
  49. Dasypus novemcinctus tRNA-Lys (TTT) (tRNA-Lys-TTT-2 1 to 3)
  50. Dipodomys ordii tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 7)
  51. Echinops telfairi tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  52. Egretta garzetta tRNA
  53. Eptesicus nilssonii tRNA-Lys
  54. Equus caballus tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 8)
  55. Erinaceus europaeus tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 5)
  56. Felis catus tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  57. Ficedula albicollis tRNA
  58. Fukomys damarensis tRNA
  59. Gadus morhua tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 7)
  60. Gallus gallus tRNA-Lys (TTT) (tRNA-Lys-TTT-1-1, tRNA-Lys-TTT-1-2)
  61. Gasterosteus aculeatus tRNA
  62. Geospiza fortis tRNA-Lys (TTT) (tRNA-Lys-TTT-1-1, tRNA-Lys-TTT-1-2)
  63. Gorilla gorilla gorilla tRNA-Lys (TTT) (tRNA-Lys-TTT-2 1 to 6)
  64. Heterocephalus glaber tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 4)
  65. Hippoglossus stenolepis (Pacific halibut) tRNA-Lys
  66. Homo sapiens tRNA-Lys (anticodon TTT) 3-1 (TRK-TTT3 1 to 5)
  67. Ichneumon xanthorius (Ichneumon Wasp) misc RNA ENSIXAG00005006276.1
  68. Ictidomys tridecemlineatus tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 5)
  69. Lamprotornis superbus tRNA-OTHER
  70. Larimichthys crocea tRNA
  71. Latimeria chalumnae tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 5)
  72. Lepisosteus oculatus tRNA
  73. Linepithema humile tRNA-Lys
  74. Lonchura striata domestica tRNA
  75. Loxodonta africana tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 5)
  76. Manacus vitellinus (golden-collared manakin) tRNA
  77. Marmota monax (woodchuck) tRNA.Lys
  78. Megalops atlanticus tRNA-Lys
  79. Meleagris gallopavo tRNA-Lys (TTT) (tRNA-Lys-TTT-1-1, tRNA-Lys-TTT-1-2)
  80. Melipona bicolor tRNA-Lys
  81. Melipona quadrifasciata tRNA
  82. Melopsittacus undulatus tRNA-Lys (TTT) (tRNA-Lys-TTT-1-1)
  83. Merluccius polli tRNA-Lys
  84. Merops nubicus tRNA
  85. Mesocricetus auratus (golden hamster) tRNA
  86. Microcebus murinus tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 7)
  87. Monodelphis domestica tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 10)
  88. Mus caroli tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  89. Mus musculus castaneus tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  90. Mus musculus domesticus tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  91. Mus musculus musculus tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  92. Mus musculus tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  93. Mus pahari tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  94. Mus spretus tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  95. Mustela putorius furo tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  96. Myotis brandtii tRNA
  97. Myotis davidii tRNA
  98. Myotis lucifugus tRNA-Lys (TTT) (tRNA-Lys-TTT-1-1, tRNA-Lys-TTT-1-2)
  99. Nasonia vitripennis tRNA-Lys
  100. Neodiprion lecontei tRNA-Lys
  101. Neodiprion pinetum tRNA-Lys
  102. Neotoma lepida (desert woodrat) tRNA
  103. Nipponia nippon (crested ibis) tRNA
  104. Nomascus leucogenys tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  105. Notamacropus eugenii tRNA-Lys (TTT) (tRNA-Lys-TTT-2 1 to 3)
  106. Nothobranchius furzeri tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 4)
  107. Ochotona princeps tRNA-Lys (TTT) (tRNA-Lys-TTT-2 1 to 4)
  108. Ophiophagus hannah (king cobra) tRNA
  109. Oreochromis niloticus tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 7)
  110. Ornithorhynchus anatinus tRNA-Lys (TTT) (tRNA-Lys-TTT-2 1 to 7)
  111. Oryctolagus cuniculus tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 5)
  112. Oryzias latipes tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 4)
  113. Otolemur garnettii tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 5)
  114. Ovis aries tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 7)
  115. Pangasianodon gigas tRNA-Lys
  116. Pangasianodon hypophthalmus tRNA-Lys
  117. Pangasius djambal tRNA-Lys
  118. Pan troglodytes tRNA-Lys (TTT) (tRNA-Lys-TTT-3 1 to 6)
  119. Papio anubis tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  120. Patagioenas fasciata monilis tRNA
  121. Pelobates cultripes tRNA.Lys
  122. Pelodiscus sinensis (Chinese softshell turtle) tRNA
  123. Perca flavescens (yellow perch) tRNA-Lys
  124. Perca fluviatilis (European perch) tRNA-Lys
  125. Petromyzon marinus tRNA-Lys (TTT) (tRNA-Lys-TTT-2 1 to 17)
  126. Phrynosoma platyrhinos (Desert horned lizard) tRNA-OTHER
  127. Dryobates pubescens tRNA
  128. Pleuronectes platessa (European plaice) tRNA-Lys
  129. Podarcis lilfordi tRNA.Lys
  130. Poecilia formosa tRNA
  131. Polistes canadensis (Red paper wasp) tRNA-Lys
  132. Polistes dominula (European paper wasp) tRNA-Lys
  133. Polistes fuscatus tRNA-Lys
  134. Pongo abelii tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  135. Procavia capensis tRNA-Lys (TTT) (tRNA-Lys-TTT-2 1 to 5)
  136. Pteropus alecto (black flying fox) tRNA
  137. Rattus norvegicus tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  138. Saimiri boliviensis boliviensis tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 5)
  139. Salmo salar tRNA
  140. Sarcophilus harrisii tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 9)
  141. Schistocephalus solidus tRNA
  142. Scleropages formosus (Asian bonytongue) tRNA
  143. Sorex araneus tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 6)
  144. Sphaerodactylus townsendi tRNA-Lys
  145. Struthio camelus australis tRNA
  146. Sus scrofa tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 7)
  147. Taeniopygia guttata tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 4)
  148. Takifugu rubripes tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 5)
  149. Tetraodon nigroviridis tRNA
  150. Tinamus guttatus tRNA
  151. Trachymyrmex cornetzi tRNA
  152. Trachymyrmex septentrionalis tRNA
  153. Trachymyrmex zeteki tRNA
  154. Trichechus manatus latirostris tRNA-Lys (TTT) (tRNA-Lys-TTT-1-1, tRNA-Lys-TTT-1-2)
  155. Trichogramma pretiosum tRNA-Lys
  156. Trichomalopsis sarcophagae tRNA
  157. Tupaia chinensis tRNA
  158. Tursiops truncatus tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 3)
  159. Vicugna pacos tRNA-Lys (TTT) (tRNA-Lys-TTT-1 1 to 7)
  160. Xenopus laevis tRNA
  161. Xenopus tropicalis tRNA-Lys (TTT) (tRNA-Lys-TTT-3 1 to 79)
  162. Xiphophorus maculatus tRNA
2D structure Publications