Sorghum bicolor (sorghum) sbi-miR169m URS00002250DC_4558

• 21 nucleotides
• 2 databases (ENA, miRBase)
• Found in 15 other species
• 1 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UAGCCAAGGAUGACUUGCCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

1. Aegilops tauschii ata-miR169c-5p
2. Ananas comosus (pineapple) microRNA 169f
3. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR169a
4. Brachypodium distachyon bdi-miR169n
5. Brassica napus bna-miR169e
6. Lolium arundinaceum (tall fescue) far-miR169
7. Manihot esculenta mes-miR169ab
8. Oryza sativa (Asian cultivated rice) osa-miR169f.1
9. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR169g
10. Populus trichocarpa ptc-miR169r
11. Salvia sclarea ssl-miR169
12. Solanum lycopersicum sly-miR169d
13. Theobroma cacao (cacao) tcc-miR169d
14. Vitis vinifera vvi-miR169x
15. Zea mays (maize) zma-miR169f-5p

Publications Download

• FASTA
• JSON