Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Theobroma cacao (cacao) tcc-miR169d URS00002250DC_3641

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCCAAGGAUGACUUGCCUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Aegilops tauschii ata-miR169c-5p
  2. Ananas comosus (pineapple) microRNA 169f
  3. Aquilegia coerulea (Rocky Mountain columbine) aqc-miR169a
  4. Brachypodium distachyon bdi-miR169n
  5. Brassica napus bna-miR169e
  6. Lolium arundinaceum (tall fescue) far-miR169
  7. Manihot esculenta mes-miR169ab
  8. Oryza sativa (Asian cultivated rice) osa-miR169f.1
  9. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR169g
  10. Populus trichocarpa ptc-miR169r
  11. Salvia sclarea ssl-miR169
  12. Solanum lycopersicum sly-miR169d
  13. Sorghum bicolor sbi-miR169m
  14. Vitis vinifera vvi-miR169x
  15. Zea mays (maize) zma-miR169f-5p