Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-263a-3p URS0000215D92_7091

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bmo-mir-263a: Bmo-mir-263a is an isoform of mature sequences that is highly accumulated in three libraries and should be considered the final functional molecule [PMC2838851]. The read counts of bmo-mir-263a were significantly higher than those of bmo-miR-263b in each library [PMC2838851]. Bmo-mir-263a, along with other miRNAs such as bmo-let-7b, bmo-let-7c, bmo-miR-9, and bmo-miR-9*, were expressed in larva and pupa but not detected in the moth stage [PMC2435238]. The higher expression of bmo-miR-1 and bmo-mir-263a suggests their functional roles in regulating silkworm development [PMC3048847]. Real-time PCR analysis was performed to examine the expression patterns of several miRNAs including bmo-mir-263a [PMC2500172]. Most miRNAs, including bmo-mir-263a, were found to be development-related [PMC2500172]. Bmo-mir-263a has nucleotide differences compared to its predicted sequence or homologs in closely related species but these differences may not affect its regulatory roles due to the mechanism for selecting target genes based on nucleotide shuffling of a 7-nucleotide seed sequence starting from the second nucleotide at the 5' end of miRNAs [PMC2500172]. Direct cloning allowed for the identification of mature sequences with variations in their 5' and/or 3' ends on the same stem as their precursors, including bmo-mir-263a [PMC2500172]. Bmo-miR8, BmomiR9a, and BmomiR263 showed a slight elevation after diapause-broken stage and maintained a relatively constant level thereafter [PMC2500172]. Bmo-mir-263a plays a crucial role in posterior gland development [PMC4045974].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CGUGAUCUCUUAGUGGCAUCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications