v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-30b-3p URS00002152A8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-30b: Hsa-mir-30b is a microRNA involved in the regulation of gene expression, specifically targeting genes related to autophagy, such as Beclin-1 and ATG5 [PMC3885199]. The significance of hsa-mir-30b in the context of autophagy was further substantiated by a study that confirmed its role in directly targeting and potentially downregulating the expression of these genes [PMC3885199]. The quantification and analysis of hsa-mir-30b were facilitated by TaqMan assays, a reliable method for measuring microRNA levels [PMC7177752]. These assays are part of a suite provided by Applied Biosystems for various microRNAs, including hsa-mir-30b, which is cataloged under the number 000602 [PMC7177752].

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUGGGAGGUGGAUGUUUACUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 16 other species

  1. Alligator mississippiensis (American alligator) ami-miR-30b-3p
  2. Bos taurus (domestic cattle) Bta-Mir-30-P2a_3p* (star (passenger))
  3. Canis lupus familiaris (dog) Cfa-Mir-30-P2a_3p* (star (passenger))
  4. Capra hircus chi-miR-30b-3p
  5. Chrysemys picta bellii Cpi-Mir-30-P2a_3p* (star (passenger))
  6. Chrysemys picta (Painted turtle) cpi-miR-30b-3p
  7. Dasypus novemcinctus (nine-banded armadillo) dno-miR-30b-3p
  8. Equus caballus (horse) Eca-Mir-30-P2a_3p* (star (passenger))
  9. Loxodonta africana (African savanna elephant) Laf-Mir-30-P2a_3p* (star (passenger))
  10. Macaca mulatta mml-miR-30b-3p
  11. Microcaecilia unicolor Mun-Mir-30-P2a_3p* (star (passenger))
  12. Microcebus murinus (gray mouse lemur) Mmr-Mir-30-P2a_3p* (star (passenger))
  13. Monodelphis domestica (gray short-tailed opossum) mdo-miR-30b-3p
  14. Notamacropus eugenii (tammar wallaby) Neu-Mir-30-P2a_3p* (star (passenger))
  15. Pongo abelii (Sumatran orangutan) Pab-Mir-30-P2a_3p* (star (passenger))
  16. Sarcophilus harrisii Sha-Mir-30-P2a_3p* (star (passenger))
 Relationships

Molecular Relationships

 Publications