Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Columba livia (rock pigeon) cli-miR-301a-5p URS000020C95B_8932

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUCUGACUUUAUUGCACUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Alligator mississippiensis ami-miR-301a-5p
  2. Cavia porcellus cpo-miR-301a-5p
  3. Cervus elaphus (red deer) cel-miR-301*
  4. Cricetulus griseus (Chinese hamster) cgr-miR-301a-5p
  5. Dasypus novemcinctus dno-miR-301a-5p
  6. Gallus gallus gga-miR-301b-5p
  7. Homo sapiens hsa-miR-301a-5p
  8. Mus musculus (house mouse) mmu-miR-301a-5p
  9. Oryctolagus cuniculus ocu-miR-301a-5p
  10. Pteropus alecto pal-miR-301a-5p
  11. Taeniopygia guttata (zebra finch) tgu-miR-301-5p
  12. Xenopus laevis (African clawed frog) xla-miR-301-5p
  13. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-4689744