v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Taeniopygia guttata (zebra finch) tgu-miR-301-5p URS000020C95B_59729

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCUCUGACUUUAUUGCACUACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Alligator mississippiensis ami-miR-301a-5p
  2. Cavia porcellus cpo-miR-301a-5p
  3. Cervus elaphus (red deer) cel-miR-301*
  4. Columba livia cli-miR-301a-5p
  5. Cricetulus griseus (Chinese hamster) cgr-miR-301a-5p
  6. Dasypus novemcinctus dno-miR-301a-5p
  7. Gallus gallus gga-miR-301b-5p
  8. Homo sapiens hsa-miR-301a-5p
  9. Mus musculus (house mouse) mmu-miR-301a-5p
  10. Oryctolagus cuniculus ocu-miR-301a-5p
  11. Pteropus alecto pal-miR-301a-5p
  12. Xenopus laevis (African clawed frog) xla-miR-301-5p
  13. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-4689744
 Publications