Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-124-3p URS000020BE6A_10090

Automated summary: This miRNA sequence is 20 nucleotides long and is found in Mus musculus. Annotated by 7 databases (RefSeq, ENA, IntAct, TarBase, PirBase, PSICQUIC, miRBase). Described in 64 papers. Mus musculus (house mouse) mmu-miR-124-3p sequence is a product of Mir124a-3, Mir124a-2, mmu-miR-124, miR-124-3p, miR-124, mmu-miR-124-3p, Mir124a-1 genes. Interacts with protein-coding genes, including 0610006H10Rik, 0610006J14Rik, 0610006N12Rik, 0610006O14Rik, 0610007G24Rik, 0610007L03Rik, 0610007P14Rik, 0610008A10Rik, 0610008D19Rik, 0610008L05Rik.

Interactions 7

According to PSICQUIC and IntAct, Mus musculus (house mouse) mmu-miR-124-3p interacts with:

Interaction id Participant Synonyms
EBI-20812596 intact:EBI-20812567 EBI-20812567 ENSMUST00000062117.13 mrna_rap2a
EBI-20812580 intact:EBI-20812567 EBI-20812567 ENSMUST00000062117.13 mrna_rap2a
URS000020BE6A_10090-3 B5B2N2 B5B2N2
URS000020BE6A_10090-0 B5B2N2 B5B2N2
URS000020BE6A_10090-1 P53566 P53566
URS000020BE6A_10090-4 P53566 P53566
URS000020BE6A_10090-2 Q64261 Q64261

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAAGGCACGCGGUGAAUGCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 41 other species

    1. Caenorhabditis remanei crm-miR-124a
    2. Capra hircus chi-miR-124a
    3. Equus caballus (horse) eca-miR-124
    4. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-124
    5. Homo sapiens hsa-miR-124-3p
    6. Ictalurus punctatus (channel catfish) ipu-miR-124a
    7. Maylandia zebra mze-miR-124
    8. Neolamprologus brichardi nbr-miR-124
    9. Oreochromis niloticus oni-miR-124a
    10. Polistes canadensis pca-miR-124-3p
    11. Pongo pygmaeus ppy-miR-124
    12. Pristionchus pacificus ppc-miR-124
    13. Rattus norvegicus rno-miR-124-3p