Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Maylandia zebra (zebra mbuna) mze-miR-124 URS000020BE6A_106582

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAGGCACGCGGUGAAUGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Caenorhabditis remanei crm-miR-124a
  2. Capra hircus chi-miR-124a
  3. Equus caballus (horse) eca-miR-124
  4. Haplochromis burtoni (Burton's mouthbrooder) abu-miR-124
  5. Homo sapiens hsa-miR-124-3p
  6. Ictalurus punctatus (channel catfish) ipu-miR-124a
  7. Mus musculus (house mouse) mmu-miR-124-3p
  8. Neolamprologus brichardi (lyretail cichlid) nbr-miR-124
  9. Oreochromis niloticus oni-miR-124a
  10. Polistes canadensis pca-miR-124-3p
  11. Pongo pygmaeus (Bornean orangutan) ppy-miR-124
  12. Pristionchus pacificus ppc-miR-124
  13. Rattus norvegicus rno-miR-124-3p