v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sus scrofa (pig) ssc-mir9 URS0000202460_9823

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAUAUUAUACAGUCAACCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus bta-miR-656
  2. Canis lupus familiaris Cfa-Mir-154-P25_3p (mature (guide))
  3. Capra hircus (goat) chi-miR-656
  4. Cavia porcellus cpo-miR-656-3p
  5. Cervus elaphus (red deer) cel-miR-656
  6. Dasypus novemcinctus dno-miR-656-3p
  7. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P25_3p (mature (guide))
  8. Equus caballus eca-miR-656
  9. Homo sapiens (human) hsa-miR-656-3p
  10. Macaca mulatta mml-miR-656-3p
  11. Oryctolagus cuniculus ocu-miR-656-3p
  12. Pan troglodytes (chimpanzee) ptr-miR-656
  13. Pongo pygmaeus ppy-miR-656
  14. Pteropus alecto pal-miR-656-3p
  15. Tupaia chinensis tch-miR-656