Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cavia porcellus (domestic guinea pig) cpo-miR-656-3p URS0000202460_10141

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUAUUAUACAGUCAACCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Bos taurus bta-miR-656
  2. Canis lupus familiaris Cfa-Mir-154-P25_3p (mature (guide))
  3. Capra hircus (goat) chi-miR-656
  4. Cervus elaphus (red deer) cel-miR-656
  5. Dasypus novemcinctus dno-miR-656-3p
  6. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P25_3p (mature (guide))
  7. Equus caballus eca-miR-656
  8. Homo sapiens (human) hsa-miR-656-3p
  9. Macaca mulatta mml-miR-656-3p
  10. Oryctolagus cuniculus ocu-miR-656-3p
  11. Pan troglodytes (chimpanzee) ptr-miR-656
  12. Pongo pygmaeus ppy-miR-656
  13. Pteropus alecto pal-miR-656-3p
  14. Sus scrofa ssc-mir9
  15. Tupaia chinensis tch-miR-656