Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-2763-3p URS00001FB519_7091

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bmo-mir-2763: Bmo-mir-2763 is a novel microRNA that is specifically expressed in the pupal stage of the silkworm. It has been found to regulate diapause initiation through diapause hormone receptors [PMC5507411]. In the silkworm genome, three potential targets have been identified for bmo-mir-2763, including diapause hormone receptor-4 and nuclear receptor GRF [PMC4640560] [PMC2824724]. The expression of bmo-mir-2763 in the pupal stage is consistent with the detection of GATA-beta 3, a protein involved in choriogenesis, in pupae but not in larval tissues [PMC2824724]. Bmo-mir-2763 is predicted to target BmGATA beta isoform 3, which regulates the expression of chorion genes during late stages of choriogenesis [PMC2824724]. In larvae, bmo-mir-2763 and another novel microRNA, bmo-mir-3001, are present at low levels compared to other stages. However, in the moth stage, three novel microRNAs including bmo-miR-2998 and bmo-miR-2999 are most abundantly expressed [PMC2824724]. These findings suggest that bmo-mir-2763 plays a role in regulating developmental processes such as diapause initiation and choriogenesis during different stages of silkworm development.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUUAUGCUCAUUUCUUUGGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications