Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Solanum lycopersicum (tomato) sly-miR172c URS00001FAF8C_4081

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAAUCUUGAUGAUGCUGCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Arabidopsis lyrata (lyrate rockcress) aly-miR172d-3p
  2. Arabidopsis thaliana (thale cress) ath-miR172c
  3. Brassica napus (rape) bna-miR172d
  4. Brassica rapa bra-miR172c-3p
  5. Cucumis melo cme-miR172e
  6. Cynara cardunculus var. scolymus cca-miR172b
  7. Gossypium hirsutum (cotton) microRNA miR172
  8. Helianthus annuus (common sunflower) ath-miR172c
  9. Lotus japonicus lja-miR172a
  10. Malus domestica (apple) mdm-miR172m
  11. Nicotiana tabacum nta-miR172a
Publications