Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gossypium hirsutum (cotton) microRNA miR172 URS00001FAF8C_3635

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAAUCUUGAUGAUGCUGCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

  1. Arabidopsis lyrata (lyrate rockcress) aly-miR172d-3p
  2. Arabidopsis thaliana (thale cress) ath-miR172c
  3. Brassica napus (rape) bna-miR172d
  4. Brassica rapa bra-miR172c-3p
  5. Cucumis melo cme-miR172e
  6. Cynara cardunculus var. scolymus cca-miR172b
  7. Helianthus annuus (common sunflower) ath-miR172c
  8. Lotus japonicus lja-miR172a
  9. Malus domestica (apple) mdm-miR172m
  10. Nicotiana tabacum nta-miR172a
  11. Solanum lycopersicum sly-miR172c