Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-449a URS00001F5B39_9796

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCAGUGUAUUGUUAGCUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus (cattle) bta-miR-449a
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-449a
  3. Canis lupus familiaris cfa-miR-449a
  4. Cavia porcellus (domestic guinea pig) cpo-miR-449a-5p
  5. Cervus elaphus cel-miR-449a
  6. Cricetulus griseus cgr-miR-449a
  7. Dasypus novemcinctus dno-miR-449a-5p
  8. Echinops telfairi Ete-Mir-34-P3c_5p (mature (guide))
  9. Homo sapiens hsa-miR-449a
  10. Macaca mulatta mml-miR-449a-5p
  11. Monodelphis domestica (gray short-tailed opossum) mdo-miR-449a-5p
  12. Mus musculus mmu-miR-449a-5p
  13. Oryctolagus cuniculus ocu-miR-449a-5p
  14. Pongo pygmaeus ppy-miR-449a
  15. Pteropus alecto pal-miR-449a-5p
  16. Rattus norvegicus (Norway rat) rno-miR-449a-5p
  17. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-34-P3c_5p (mature (guide))
Publications