Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-449a-5p URS00001F5B39_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-449a: Mmu-mir-449a and mmu-miR-1894 were found to decrease the formation of lung metastasis nodules by 77.1% and 86.7%, respectively, compared to the control [PMC4849059]. Mmu-mir-449a has been identified as a tumor suppressor in endometrial cancer [PMC4849059]. In a study, mmu-mir-449a, mmu-mir-1935, and mmu-mir-1894 were shown to have significant effects on lung metastasis of cancer cells [PMC4849059]. Mmu-miR-487b and mmu-miR-1193 were among the fifteen constructs examined in the study [PMC4849059]. Mmu-mir-449a has been found to be overexpressed in NP surgical models and drug-induced NP models [PMC8794747]. The expression of mature miRNAs was assayed using TaqMan MicroRNA Assays specific for various miRNAs including mmu-mir-449a [PMC4569899]. The expression of mmu-mir-449a was significantly changed in lungs of mice exposed to nanotitanium dioxide particles [PMC5135284]. Mmu-mir-449a was identified as one of the miRNAs significantly reduced in an A-MYB mutant with an A-MYB binding peak nearby [PMC8514520]. Mmu-mir-449a was upregulated in sciatic nerves of mice [PMC8914318]. In a separate investigation, transcriptional alterations involving mmu-miR-34c, mmu-miR34b5p, and other miRNAs including mmu mir 449-a were confirmed by RT-qPCR analysis [PMC6781998].\

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCAGUGUAUUGUUAGCUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

  1. Bos taurus (cattle) bta-miR-449a
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-449a
  3. Canis lupus familiaris cfa-miR-449a
  4. Cavia porcellus (domestic guinea pig) cpo-miR-449a-5p
  5. Cervus elaphus cel-miR-449a
  6. Cricetulus griseus cgr-miR-449a
  7. Dasypus novemcinctus dno-miR-449a-5p
  8. Echinops telfairi Ete-Mir-34-P3c_5p (mature (guide))
  9. Equus caballus eca-miR-449a
  10. Homo sapiens hsa-miR-449a
  11. Macaca mulatta mml-miR-449a-5p
  12. Monodelphis domestica (gray short-tailed opossum) mdo-miR-449a-5p
  13. Oryctolagus cuniculus ocu-miR-449a-5p
  14. Pongo pygmaeus ppy-miR-449a
  15. Pteropus alecto pal-miR-449a-5p
  16. Rattus norvegicus (Norway rat) rno-miR-449a-5p
  17. Sarcophilus harrisii (Tasmanian devil) Sha-Mir-34-P3c_5p (mature (guide))
Publications