Chlorocebus sabaeus (African green monkey) microRNA 132 (ENSCSAG00000027690.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Chlorocebus sabaeus (African green monkey) microRNA 132 (ENSCSAG00000027690.1) URS00001F4E81_60711

101 nucleotides
1 database (Ensembl)
Found in 9 other species
227 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

CCGCCCCCGCGUCUCCAGGGCAACCGUGGCUUUCGAUUGUUACUGUGGGAACUGGAGGUAACAGUCUACAGCCAUGGUCGCCCCGCAGCACGCCCACGCGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Homo sapiens microRNA hsa-mir-132 precursor
Macaca mulatta microRNA mml-mir-132 precursor
Pan troglodytes (chimpanzee) miRNA
Papio anubis microRNA 132 (ENSPANG00000006950.3)
Pongo abelii (Sumatran orangutan) microRNA 132 (ENSPPYG00000021779.2)
Pongo pygmaeus microRNA ppy-mir-132 precursor

Publications