Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-379-3p URS00001EE123_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-379: Hsa-mir-379 is a microRNA that targets the 3′-UTR of Lamp2a, a protein involved in the degradation of α-Syn, a protein associated with the accumulation of α-Syn in neurodegenerative diseases [PMC7698349]. Downregulation of Hsp70 or Lamp2a leads to the accumulation of α-Syn, and several microRNAs have been identified to target the 3′-UTR of Hsp70 or Lamp2a, including hsa-miR-26b, hsa-miR-106a, hsa-miR-301b [PMC7698349]. Interestingly, hsa-mir-379 is also identified as a microRNA that targets the 3′-UTR of Lamp2a [PMC7698349]. Although not considered a top candidate, hsa-miR-1207-5p has been found to have a target site near hsa-mir-379 [PMC3271095]. This proximity suggests that hsa-miR-1207-5p may also play a role in regulating Lamp2a and potentially contribute to the accumulation of α-Syn [PMC3271095]. Further research is needed to fully understand the role and significance of these microRNAs in neurodegenerative diseases and their potential as therapeutic targets.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUGUAACAUGGUCCACUAACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Mus musculus mmu-miR-379-3p
  2. Ovis aries (sheep) oar-miR-379-3p
Publications