Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-379-3p URS00001EE123_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-379: Mmu-mir-379 is a microRNA that is part of cluster IV on chromosome 12, which includes mmu-mir-379 to 410 [PMC1421506]. It is not clear whether all miRNAs in this cluster are transcribed from a single transcriptional unit [PMC1421506]. In a microarray experiment, mmu-mir-379 was found to be upregulated in white adipose tissue (WAT) in response to high-fat diet (HFD) feeding [PMC4571067]. Quantitative PCR was performed to validate the expression of mmu-mir-379 [PMC5844870]. In another study, mmu-mir-379 was found to be upregulated in WAT after HFD-induced obesity [PMC3319598]. Additionally, mmu-miR-342-3p was also found to be upregulated after HFD-induced obesity [PMC3319598]. Conversely, miRNAs such as mmumiR122 and 203 were downregulated after HFD-induced obesity [PMC3319598].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAUGUAACAUGGUCCACUAACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Homo sapiens hsa-miR-379-3p
  2. Ovis aries (sheep) oar-miR-379-3p
Publications