Automated summary: This pre miRNA sequence is 71 nucleotides long and is found in Drosophila melanogaster. Annotated by 4 databases (ENA, FlyBase, RefSeq, miRBase). Has a conserved secondary structure or a structured region. Drosophila melanogaster (fruit fly) microRNA dme-mir-313 precursor sequence is a product of 313 precursor RN, mir-313, mir-313 precursor, dme-mir-313 precursor, mir-313 precurso, mir-313 precursor RNA, FBgn0262441, 313 precursor RNA, 313 genes. Found in the fruit fly reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AUUUUCUGCUGCGGAUGGGGGCAGUACUGUUUUUUUAACAUUGAGUAUUGCACUUUUCACAGCCCGAAAAU
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.