Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae S288C tRNA-Val secondary structure diagram

Saccharomyces cerevisiae S288C tRNA-Val URS00001D5F0C_559292

Automated summary: This tRNA sequence is 74 nucleotides long and is found in Saccharomyces cerevisiae S288C. Annotated by 3 databases (SGD, GtRNAdb, ENA). Has a conserved secondary structure or a structured region. Saccharomyces cerevisiae S288C tRNA-Val sequence is a product of tRNA-Val-AAC-1-6, tRNA-Val-AAC-1-13, tRNA-Val-AAC-1-5, tRNA-Val-AAC-1-11, tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-12, tRNA-Val-AAC-1-4, tRNA-Val-AAC-1-3, tRNA-Val-AAC-1-8, tRNA-Val-AAC-1-10, tRNA-Val-AAC-1-7, tRNA-Val-AAC-1-2, tRNA-Val-AAC-1-9 genes. Found in the Saccharomyces cerevisiae S288C reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Localisation

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    GGUUUCGUGGUCUAGUCGGUUAUGGCAUCUGCUUAACACGCAGAACGUCCCCAGUUCGAUCCUGGGCGAAAUCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 164 other species

    1. [Ashbya] aceris (nom. inval.) tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 5)
    2. [Candida] glabrata CBS 138 tRNA tV(AAC)10
    3. [Candida] glabrata tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 10)
    4. Eremothecium cymbalariae DBVPG#7215 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
    5. Eremothecium gossypii ATCC 10895 tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 7)
    6. Eremothecium gossypii FDAG1 tRNA-Val
    7. Eremothecium sinecaudum tRNA-Val
    8. Kazachstania exigua tRNA-Val
    9. Kazachstania naganishii CBS 8797 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 7)
    10. Klebsiella oxytoca tRNA-Val
    11. Kluyveromyces dobzhanskii CBS 2104 tRNA-Val
    12. Kluyveromyces lactis tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 7)
    13. Kluyveromyces marxianus tRNA-Val
    14. Kluyveromyces marxianus var. marxianus KCTC 17555 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 6, tRNA-Val-AAC-3-1)
    15. Lachancea dasiensis CBS 10888 tRNA-Val (AAC) cove score=68.42
    16. Lachancea dasiensis tRNA-Val (AAC) cove score=68.42
    17. Lachancea fermentati tRNA-Val (AAC) cove score=68.42
    18. Lachancea kluyveri NRRL Y-12651 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 14)
    19. Lachancea kluyveri partial transfer RNA
    20. Lachancea lanzarotensis tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 9)
    21. Lachancea meyersii CBS 8951 tRNA-Val (AAC) cove score=68.42
    22. Lachancea mirantina tRNA-Val (AAC) cove score=68.42
    23. Lachancea nothofagi CBS 11611 tRNA-Val (AAC) cove score=68.42
    24. Lachancea quebecensis transfer RNA
    25. Lachancea sp. CBS 6924 tRNA-Val (AAC) cove score=68.42
    26. Lachancea thermotolerans CBS 6340 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 10)
    27. Lachancea thermotolerans partial transfer RNA
    28. Naumovozyma castellii CBS 4309 tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 11)
    29. Naumovozyma dairenensis CBS 421 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 14)
    30. Saccharomyces arboricola H-6 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 12)
    31. Saccharomyces boulardii (nom. inval.) tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 15)
    32. Saccharomyces cerevisiae AWRI796 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 11)
    33. Saccharomyces cerevisiae tRNA
    34. Saccharomyces cerevisiae CBS 7960 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 14)
    35. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 12)
    36. Saccharomyces cerevisiae CLIB215 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 11)
    37. Saccharomyces cerevisiae CLIB324 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 9)
    38. Saccharomyces cerevisiae CLIB382 tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
    39. Saccharomyces cerevisiae EC1118 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 13)
    40. Saccharomyces cerevisiae EC9-8 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 12)
    41. Saccharomyces cerevisiae FL100 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 13)
    42. Saccharomyces cerevisiae FostersB tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 10)
    43. Saccharomyces cerevisiae FostersO tRNA
    44. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 9, tRNA-Val-AAC-3 1 to 4)
    45. Saccharomyces cerevisiae Lalvin QA23 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 12)
    46. Saccharomyces cerevisiae P283 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 12)
    47. Saccharomyces cerevisiae P301 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 12)
    48. Saccharomyces cerevisiae PE-2 tRNA-Val
    49. Saccharomyces cerevisiae PW5 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 8)
    50. Saccharomyces cerevisiae R008 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 14)
    51. Saccharomyces cerevisiae R103 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 12)
    52. Saccharomyces cerevisiae RM11-1a tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 14)
    53. Saccharomyces cerevisiae Sigma1278b tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 14)
    54. Saccharomyces cerevisiae T73 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 12)
    55. Saccharomyces cerevisiae T7 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 14)
    56. Saccharomyces cerevisiae UC5 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 8)
    57. Saccharomyces cerevisiae UFMG A-905 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 15)
    58. Saccharomyces cerevisiae Vin13 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 14)
    59. Saccharomyces cerevisiae VL3 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 12)
    60. Saccharomyces cerevisiae W303 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 13)
    61. Saccharomyces cerevisiae Y10 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 7)
    62. Saccharomyces cerevisiae YJM1078 tRNA-Val
    63. Saccharomyces cerevisiae YJM1083 tRNA-Val
    64. Saccharomyces cerevisiae YJM1129 tRNA-Val
    65. Saccharomyces cerevisiae YJM1133 tRNA-Val
    66. Saccharomyces cerevisiae YJM1190 tRNA-Val
    67. Saccharomyces cerevisiae YJM1199 tRNA-Val
    68. Saccharomyces cerevisiae YJM1202 tRNA-Val
    69. Saccharomyces cerevisiae YJM1208 tRNA-Val
    70. Saccharomyces cerevisiae YJM1242 tRNA-Val
    71. Saccharomyces cerevisiae YJM1244 tRNA-Val
    72. Saccharomyces cerevisiae YJM1248 tRNA-Val
    73. Saccharomyces cerevisiae YJM1250 tRNA-Val
    74. Saccharomyces cerevisiae YJM1252 tRNA-Val
    75. Saccharomyces cerevisiae YJM1273 tRNA-Val
    76. Saccharomyces cerevisiae YJM1304 tRNA-Val
    77. Saccharomyces cerevisiae YJM1307 tRNA-Val
    78. Saccharomyces cerevisiae YJM1311 tRNA-Val
    79. Saccharomyces cerevisiae YJM1326 tRNA-Val
    80. Saccharomyces cerevisiae YJM1332 tRNA-Val
    81. Saccharomyces cerevisiae YJM1336 tRNA-Val
    82. Saccharomyces cerevisiae YJM1338 tRNA-Val
    83. Saccharomyces cerevisiae YJM1341 tRNA-Val
    84. Saccharomyces cerevisiae YJM1342 tRNA-Val
    85. Saccharomyces cerevisiae YJM1355 tRNA-Val
    86. Saccharomyces cerevisiae YJM1356 tRNA-Val
    87. Saccharomyces cerevisiae YJM1381 tRNA-Val
    88. Saccharomyces cerevisiae YJM1383 tRNA-Val
    89. Saccharomyces cerevisiae YJM1385 tRNA-Val
    90. Saccharomyces cerevisiae YJM1386 tRNA-Val
    91. Saccharomyces cerevisiae YJM1387 tRNA-Val
    92. Saccharomyces cerevisiae YJM1388 tRNA-Val
    93. Saccharomyces cerevisiae YJM1389 tRNA-Val
    94. Saccharomyces cerevisiae YJM1399 tRNA-Val
    95. Saccharomyces cerevisiae YJM1400 tRNA-Val
    96. Saccharomyces cerevisiae YJM1401 tRNA-Val
    97. Saccharomyces cerevisiae YJM1402 tRNA-Val
    98. Saccharomyces cerevisiae YJM1415 tRNA-Val
    99. Saccharomyces cerevisiae YJM1417 tRNA-Val
    100. Saccharomyces cerevisiae YJM1418 tRNA-Val
    101. Saccharomyces cerevisiae YJM1419 tRNA-Val
    102. Saccharomyces cerevisiae YJM1433 tRNA-Val
    103. Saccharomyces cerevisiae YJM1434 tRNA-Val
    104. Saccharomyces cerevisiae YJM1439 tRNA-Val
    105. Saccharomyces cerevisiae YJM1443 tRNA-Val
    106. Saccharomyces cerevisiae YJM1444 tRNA-Val
    107. Saccharomyces cerevisiae YJM1447 tRNA-Val
    108. Saccharomyces cerevisiae YJM1450 tRNA-Val
    109. Saccharomyces cerevisiae YJM1460 tRNA-Val
    110. Saccharomyces cerevisiae YJM1463 tRNA-Val
    111. Saccharomyces cerevisiae YJM1477 tRNA-Val
    112. Saccharomyces cerevisiae YJM1478 tRNA-Val
    113. Saccharomyces cerevisiae YJM1479 tRNA-Val
    114. Saccharomyces cerevisiae YJM1526 tRNA-Val
    115. Saccharomyces cerevisiae YJM1527 tRNA-Val
    116. Saccharomyces cerevisiae YJM1549 tRNA-Val
    117. Saccharomyces cerevisiae YJM1573 tRNA-Val
    118. Saccharomyces cerevisiae YJM1574 tRNA-Val
    119. Saccharomyces cerevisiae YJM1592 tRNA-Val
    120. Saccharomyces cerevisiae YJM1615 tRNA-Val
    121. Saccharomyces cerevisiae YJM189 tRNA-Val
    122. Saccharomyces cerevisiae YJM193 tRNA-Val
    123. Saccharomyces cerevisiae YJM195 tRNA-Val
    124. Saccharomyces cerevisiae YJM244 tRNA-Val
    125. Saccharomyces cerevisiae YJM248 tRNA-Val
    126. Saccharomyces cerevisiae YJM269 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 13)
    127. Saccharomyces cerevisiae YJM270 tRNA-Val
    128. Saccharomyces cerevisiae YJM271 tRNA-Val
    129. Saccharomyces cerevisiae YJM320 tRNA-Val
    130. Saccharomyces cerevisiae YJM326 tRNA-Val
    131. Saccharomyces cerevisiae YJM428 tRNA-Val
    132. Saccharomyces cerevisiae YJM450 tRNA-Val
    133. Saccharomyces cerevisiae YJM451 tRNA-Val
    134. Saccharomyces cerevisiae YJM453 tRNA-Val
    135. Saccharomyces cerevisiae YJM456 tRNA-Val
    136. Saccharomyces cerevisiae YJM470 tRNA-Val
    137. Saccharomyces cerevisiae YJM541 tRNA-Val
    138. Saccharomyces cerevisiae YJM554 tRNA-Val
    139. Saccharomyces cerevisiae YJM555 tRNA-Val
    140. Saccharomyces cerevisiae YJM627 tRNA-Val
    141. Saccharomyces cerevisiae YJM681 tRNA-Val
    142. Saccharomyces cerevisiae YJM682 tRNA-Val
    143. Saccharomyces cerevisiae YJM683 tRNA-Val
    144. Saccharomyces cerevisiae YJM689 tRNA-Val
    145. Saccharomyces cerevisiae YJM693 tRNA-Val
    146. Saccharomyces cerevisiae YJM969 tRNA-Val
    147. Saccharomyces cerevisiae YJM972 tRNA-Val
    148. Saccharomyces cerevisiae YJM975 tRNA-Val
    149. Saccharomyces cerevisiae YJM978 tRNA-Val
    150. Saccharomyces cerevisiae YJM981 tRNA-Val
    151. Saccharomyces cerevisiae YJM984 tRNA-Val
    152. Saccharomyces cerevisiae YJM987 tRNA-Val
    153. Saccharomyces cerevisiae YJM990 tRNA-Val
    154. Saccharomyces cerevisiae YJM993 tRNA-Val
    155. Saccharomyces cerevisiae YJM996 tRNA-Val
    156. Saccharomyces cerevisiae YJSH1 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 9, tRNA-Val-AAC-3 1 to 4)
    157. Saccharomyces eubayanus tRNA-Val
    158. Saccharomyces kudriavzevii IFO 1802 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 8)
    159. Saccharomyces kudriavzevii ZP591 tRNA-Val
    160. Saccharomyces mikatae IFO 1815 tRNA-Val
    161. Saccharomyces pastorianus tRNA-Val
    162. Saccharomyces uvarum tRNA-Val
    163. Tetrapisispora phaffii CBS 4417 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 10)
    164. Torulaspora globosa tRNA-Val
    165. Vector YCy2508 tRNA-Val
    166. Zygotorulaspora mrakii tRNA-Val
    2D structure Publications