Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Tetrapisispora phaffii CBS 4417 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 10) secondary structure diagram

Tetrapisispora phaffii CBS 4417 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 10) URS00001D5F0C_1071381

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUUCGUGGUCUAGUCGGUUAUGGCAUCUGCUUAACACGCAGAACGUCCCCAGUUCGAUCCUGGGCGAAAUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 170 other species

  1. [Ashbya] aceris (nom. inval.) tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 5)
  2. Nakaseomyces glabratus CBS 138 tRNA tV(AAC)10
  3. Eremothecium cymbalariae DBVPG#7215 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 5)
  4. Eremothecium gossypii ATCC 10895 tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 7)
  5. Eremothecium gossypii FDAG1 tRNA-Val
  6. Eremothecium sinecaudum tRNA-Val
  7. Fusarium falciforme tRNA-Val
  8. Fusarium oxysporum tRNA-Val
  9. Kazachstania bulderi transfer RNA-Val(AAC)
  10. Kazachstania exigua tRNA-Val
  11. Kazachstania naganishii CBS 8797 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 7)
  12. Klebsiella oxytoca tRNA-Val
  13. Kluyveromyces dobzhanskii CBS 2104 tRNA-Val
  14. Kluyveromyces lactis tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 7)
  15. Kluyveromyces marxianus partial transfer RNA
  16. Kluyveromyces marxianus var. marxianus KCTC 17555 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 6, tRNA-Val-AAC-3-1)
  17. Lachancea dasiensis CBS 10888 tRNA-Val (AAC) cove score=68.42
  18. Lachancea dasiensis tRNA-Val (AAC) cove score=68.42
  19. Lachancea fermentati tRNA-Val (AAC) cove score=68.42
  20. Lachancea kluyveri NRRL Y-12651 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 14)
  21. Lachancea kluyveri partial transfer RNA
  22. Lachancea lanzarotensis tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 9)
  23. Lachancea meyersii CBS 8951 tRNA-Val (AAC) cove score=68.42
  24. Lachancea mirantina tRNA-Val (AAC) cove score=68.42
  25. Lachancea nothofagi CBS 11611 tRNA-Val (AAC) cove score=68.42
  26. Lachancea quebecensis transfer RNA
  27. Lachancea sp. 'fantastica' tRNA-Val (AAC) cove score=68.42
  28. Lachancea thermotolerans CBS 6340 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 10)
  29. Lachancea thermotolerans partial transfer RNA
  30. Nakaseomyces glabratus tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 10)
  31. Naumovozyma castellii CBS 4309 tRNA-Val (AAC) (tRNA-Val-AAC-2 1 to 11)
  32. Naumovozyma dairenensis CBS 421 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 14)
  33. Saccharomyces arboricola H-6 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 12)
  34. Saccharomyces boulardii (nom. inval.) tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 15)
  35. Saccharomyces cerevisiae AWRI796 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 11)
  36. Saccharomyces cerevisiae tRNA
  37. Saccharomyces cerevisiae CBS 7960 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 14)
  38. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 12)
  39. Saccharomyces cerevisiae CLIB215 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 11)
  40. Saccharomyces cerevisiae CLIB324 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 9)
  41. Saccharomyces cerevisiae CLIB382 tRNA-Val (AAC) (tRNA-Val-AAC-1-1, tRNA-Val-AAC-1-2)
  42. Saccharomyces cerevisiae EC1118 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 13)
  43. Saccharomyces cerevisiae EC9-8 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 12)
  44. Saccharomyces cerevisiae FL100 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 13)
  45. Saccharomyces cerevisiae FostersB tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 10)
  46. Saccharomyces cerevisiae FostersO tRNA
  47. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 9, tRNA-Val-AAC-3 1 to 4)
  48. Saccharomyces cerevisiae Lalvin QA23 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 12)
  49. Saccharomyces cerevisiae P283 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 12)
  50. Saccharomyces cerevisiae P301 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 12)
  51. Saccharomyces cerevisiae PE-2 tRNA-Val
  52. Saccharomyces cerevisiae PW5 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 8)
  53. Saccharomyces cerevisiae R008 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 14)
  54. Saccharomyces cerevisiae R103 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 12)
  55. Saccharomyces cerevisiae RM11-1a tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 14)
  56. Saccharomyces cerevisiae S288C tRNA-Val
  57. Saccharomyces cerevisiae Sigma1278b tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 14)
  58. Saccharomyces cerevisiae synthetic construct tRNA-Val
  59. Saccharomyces cerevisiae T73 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 12)
  60. Saccharomyces cerevisiae T7 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 14)
  61. Saccharomyces cerevisiae UC5 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 8)
  62. Saccharomyces cerevisiae UFMG A-905 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 15)
  63. Saccharomyces cerevisiae Vin13 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 14)
  64. Saccharomyces cerevisiae VL3 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 12)
  65. Saccharomyces cerevisiae W303 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 13)
  66. Saccharomyces cerevisiae Y10 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 7)
  67. Saccharomyces cerevisiae YJM1078 tRNA-Val
  68. Saccharomyces cerevisiae YJM1083 tRNA-Val
  69. Saccharomyces cerevisiae YJM1129 tRNA-Val
  70. Saccharomyces cerevisiae YJM1133 tRNA-Val
  71. Saccharomyces cerevisiae YJM1190 tRNA-Val
  72. Saccharomyces cerevisiae YJM1199 tRNA-Val
  73. Saccharomyces cerevisiae YJM1202 tRNA-Val
  74. Saccharomyces cerevisiae YJM1208 tRNA-Val
  75. Saccharomyces cerevisiae YJM1242 tRNA-Val
  76. Saccharomyces cerevisiae YJM1244 tRNA-Val
  77. Saccharomyces cerevisiae YJM1248 tRNA-Val
  78. Saccharomyces cerevisiae YJM1250 tRNA-Val
  79. Saccharomyces cerevisiae YJM1252 tRNA-Val
  80. Saccharomyces cerevisiae YJM1273 tRNA-Val
  81. Saccharomyces cerevisiae YJM1304 tRNA-Val
  82. Saccharomyces cerevisiae YJM1307 tRNA-Val
  83. Saccharomyces cerevisiae YJM1311 tRNA-Val
  84. Saccharomyces cerevisiae YJM1326 tRNA-Val
  85. Saccharomyces cerevisiae YJM1332 tRNA-Val
  86. Saccharomyces cerevisiae YJM1336 tRNA-Val
  87. Saccharomyces cerevisiae YJM1338 tRNA-Val
  88. Saccharomyces cerevisiae YJM1341 tRNA-Val
  89. Saccharomyces cerevisiae YJM1342 tRNA-Val
  90. Saccharomyces cerevisiae YJM1355 tRNA-Val
  91. Saccharomyces cerevisiae YJM1356 tRNA-Val
  92. Saccharomyces cerevisiae YJM1381 tRNA-Val
  93. Saccharomyces cerevisiae YJM1383 tRNA-Val
  94. Saccharomyces cerevisiae YJM1385 tRNA-Val
  95. Saccharomyces cerevisiae YJM1386 tRNA-Val
  96. Saccharomyces cerevisiae YJM1387 tRNA-Val
  97. Saccharomyces cerevisiae YJM1388 tRNA-Val
  98. Saccharomyces cerevisiae YJM1389 tRNA-Val
  99. Saccharomyces cerevisiae YJM1399 tRNA-Val
  100. Saccharomyces cerevisiae YJM1400 tRNA-Val
  101. Saccharomyces cerevisiae YJM1401 tRNA-Val
  102. Saccharomyces cerevisiae YJM1402 tRNA-Val
  103. Saccharomyces cerevisiae YJM1415 tRNA-Val
  104. Saccharomyces cerevisiae YJM1417 tRNA-Val
  105. Saccharomyces cerevisiae YJM1418 tRNA-Val
  106. Saccharomyces cerevisiae YJM1419 tRNA-Val
  107. Saccharomyces cerevisiae YJM1433 tRNA-Val
  108. Saccharomyces cerevisiae YJM1434 tRNA-Val
  109. Saccharomyces cerevisiae YJM1439 tRNA-Val
  110. Saccharomyces cerevisiae YJM1443 tRNA-Val
  111. Saccharomyces cerevisiae YJM1444 tRNA-Val
  112. Saccharomyces cerevisiae YJM1447 tRNA-Val
  113. Saccharomyces cerevisiae YJM1450 tRNA-Val
  114. Saccharomyces cerevisiae YJM1460 tRNA-Val
  115. Saccharomyces cerevisiae YJM1463 tRNA-Val
  116. Saccharomyces cerevisiae YJM1477 tRNA-Val
  117. Saccharomyces cerevisiae YJM1478 tRNA-Val
  118. Saccharomyces cerevisiae YJM1479 tRNA-Val
  119. Saccharomyces cerevisiae YJM1526 tRNA-Val
  120. Saccharomyces cerevisiae YJM1527 tRNA-Val
  121. Saccharomyces cerevisiae YJM1549 tRNA-Val
  122. Saccharomyces cerevisiae YJM1573 tRNA-Val
  123. Saccharomyces cerevisiae YJM1574 tRNA-Val
  124. Saccharomyces cerevisiae YJM1592 tRNA-Val
  125. Saccharomyces cerevisiae YJM1615 tRNA-Val
  126. Saccharomyces cerevisiae YJM189 tRNA-Val
  127. Saccharomyces cerevisiae YJM193 tRNA-Val
  128. Saccharomyces cerevisiae YJM195 tRNA-Val
  129. Saccharomyces cerevisiae YJM244 tRNA-Val
  130. Saccharomyces cerevisiae YJM248 tRNA-Val
  131. Saccharomyces cerevisiae YJM269 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 13)
  132. Saccharomyces cerevisiae YJM270 tRNA-Val
  133. Saccharomyces cerevisiae YJM271 tRNA-Val
  134. Saccharomyces cerevisiae YJM320 tRNA-Val
  135. Saccharomyces cerevisiae YJM326 tRNA-Val
  136. Saccharomyces cerevisiae YJM428 tRNA-Val
  137. Saccharomyces cerevisiae YJM450 tRNA-Val
  138. Saccharomyces cerevisiae YJM451 tRNA-Val
  139. Saccharomyces cerevisiae YJM453 tRNA-Val
  140. Saccharomyces cerevisiae YJM456 tRNA-Val
  141. Saccharomyces cerevisiae YJM470 tRNA-Val
  142. Saccharomyces cerevisiae YJM541 tRNA-Val
  143. Saccharomyces cerevisiae YJM554 tRNA-Val
  144. Saccharomyces cerevisiae YJM555 tRNA-Val
  145. Saccharomyces cerevisiae YJM627 tRNA-Val
  146. Saccharomyces cerevisiae YJM681 tRNA-Val
  147. Saccharomyces cerevisiae YJM682 tRNA-Val
  148. Saccharomyces cerevisiae YJM683 tRNA-Val
  149. Saccharomyces cerevisiae YJM689 tRNA-Val
  150. Saccharomyces cerevisiae YJM693 tRNA-Val
  151. Saccharomyces cerevisiae YJM969 tRNA-Val
  152. Saccharomyces cerevisiae YJM972 tRNA-Val
  153. Saccharomyces cerevisiae YJM975 tRNA-Val
  154. Saccharomyces cerevisiae YJM978 tRNA-Val
  155. Saccharomyces cerevisiae YJM981 tRNA-Val
  156. Saccharomyces cerevisiae YJM984 tRNA-Val
  157. Saccharomyces cerevisiae YJM987 tRNA-Val
  158. Saccharomyces cerevisiae YJM990 tRNA-Val
  159. Saccharomyces cerevisiae YJM993 tRNA-Val
  160. Saccharomyces cerevisiae YJM996 tRNA-Val
  161. Saccharomyces cerevisiae YJSH1 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 9, tRNA-Val-AAC-3 1 to 4)
  162. Saccharomyces eubayanus tRNA-Val
  163. Saccharomyces kudriavzevii IFO 1802 tRNA-Val (AAC) (tRNA-Val-AAC-1 1 to 8)
  164. Saccharomyces kudriavzevii ZP591 tRNA-Val
  165. Saccharomyces mikatae IFO 1815 tRNA-Val
  166. Saccharomyces pastorianus tRNA-Val
  167. Saccharomyces uvarum tRNA-Val
  168. Torulaspora globosa tRNA-Val
  169. Vector YCy2508 tRNA-Val
  170. Zygotorulaspora mrakii tRNA-Val
2D structure Publications