v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-367-3p URS00001D5AA3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-367: Hsa-mir-367 is a microRNA that is downregulated in both primary and metastatic colon cancer cells, as well as in hepatocellular carcinoma (HCC) tissues with venous metastasis [PMC9941246] [PMC6287006]. It has been shown to be involved in the regulation of cell cycle, cell differentiation, migration, and invasion [PMC9941246]. Hsa-mir-367 has been experimentally validated in various cell types and tissues, including neurons and embryonic stem cells [PMC2674674]. It is also a member of the hsa-miR-371-373 cluster, which has been identified as a potential biomarker for diagnosis, prognosis, and cancer therapy response evaluation [PMC9505168]. Hsa-mir-367 has been found to target ORF-3a in SARS-CoV-2 [PMC9160520]. The expression of hsa-mir-367 is consistently associated with germ cells during the development of testicular germ cell tumors (TGCT) [PMC9505168]. Overall, hsa-mir-367 plays important roles in various biological processes and may have potential clinical applications [PMC9941246].

mRNA interactions 2 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAUUGCACUUUAGCAAUGGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Alligator mississippiensis Ami-Mir-92-P2a_3p (mature (guide))
  2. Anolis carolinensis (green anole) aca-miR-367
  3. Bos taurus Bta-Mir-92-P2a_3p (mature (guide))
  4. Canis lupus familiaris Cfa-Mir-92-P2a_3p (mature (guide))
  5. Cavia porcellus cpo-miR-367-3p
  6. Chrysemys picta bellii Cpi-Mir-92-P2a_3p (mature (guide))
  7. Columba livia (rock pigeon) cli-miR-367-3p
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-367-3p
  9. Echinops telfairi Ete-Mir-92-P2a_3p (mature (guide))
  10. Equus caballus (horse) eca-miR-367
  11. Gallus gallus Gga-Mir-92-P2a_3p (mature (guide))
  12. Gekko japonicus Gja-Mir-92-P2a_3p (mature (guide))
  13. Macaca mulatta mml-miR-367
  14. Microcaecilia unicolor Mun-Mir-92-P2a_3p (mature (guide))
  15. Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-92-P2a_3p (mature (guide))
  16. Mus musculus (house mouse) mmu-miR-367-3p
  17. Ornithorhynchus anatinus Oan-Mir-92-P2a_3p (mature (guide))
  18. Oryctolagus cuniculus ocu-miR-367-3p
  19. Pan troglodytes (chimpanzee) ptr-miR-367
  20. Pongo pygmaeus ppy-miR-367
  21. Rattus norvegicus (Norway rat) Rno-Mir-92-P2a_3p (mature (guide))
  22. Sarcophilus harrisii Sha-Mir-92-P2a_3p (mature (guide))
  23. Sphenodon punctatus (tuatara) Spt-Mir-92-P2a_3p (mature (guide))
  24. Taeniopygia guttata tgu-miR-367
 Publications