v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Monodelphis domestica (gray short-tailed opossum) Mdo-Mir-92-P2a_3p (mature (guide)) URS00001D5AA3_13616

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAUUGCACUUUAGCAAUGGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Alligator mississippiensis Ami-Mir-92-P2a_3p (mature (guide))
  2. Anolis carolinensis (green anole) aca-miR-367
  3. Bos taurus Bta-Mir-92-P2a_3p (mature (guide))
  4. Canis lupus familiaris Cfa-Mir-92-P2a_3p (mature (guide))
  5. Cavia porcellus cpo-miR-367-3p
  6. Chrysemys picta bellii Cpi-Mir-92-P2a_3p (mature (guide))
  7. Columba livia (rock pigeon) cli-miR-367-3p
  8. Dasypus novemcinctus (nine-banded armadillo) dno-miR-367-3p
  9. Echinops telfairi Ete-Mir-92-P2a_3p (mature (guide))
  10. Equus caballus (horse) eca-miR-367
  11. Gallus gallus Gga-Mir-92-P2a_3p (mature (guide))
  12. Gekko japonicus Gja-Mir-92-P2a_3p (mature (guide))
  13. Homo sapiens hsa-miR-367-3p
  14. Macaca mulatta mml-miR-367
  15. Microcaecilia unicolor Mun-Mir-92-P2a_3p (mature (guide))
  16. Mus musculus (house mouse) mmu-miR-367-3p
  17. Ornithorhynchus anatinus Oan-Mir-92-P2a_3p (mature (guide))
  18. Oryctolagus cuniculus ocu-miR-367-3p
  19. Pan troglodytes (chimpanzee) ptr-miR-367
  20. Pongo pygmaeus ppy-miR-367
  21. Rattus norvegicus (Norway rat) Rno-Mir-92-P2a_3p (mature (guide))
  22. Sarcophilus harrisii Sha-Mir-92-P2a_3p (mature (guide))
  23. Sphenodon punctatus (tuatara) Spt-Mir-92-P2a_3p (mature (guide))
  24. Taeniopygia guttata tgu-miR-367