Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Polistes canadensis pca-miR-965-3p URS00001CA257_91411

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAGCGUAUAGCUUUUCCCCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

  1. Acyrthosiphon pisum api-miR-965
  2. Bombyx mori (domestic silkworm) bmo-miR-965-3p
  3. Drosophila ananassae Dan-Mir-965_3p (mature (guide))
  4. Drosophila melanogaster (fruit fly) dme-miR-965-3p
  5. Drosophila mojavensis Dmo-Mir-965_3p (mature (co-guide))
  6. Drosophila pseudoobscura dps-miR-965-3p
  7. Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0330777_df_nrg
  8. Drosophila simulans dsi-miR-965-3p
  9. Drosophila yakuba Dya-Mir-965_3p (mature (guide))
  10. Heliconius melpomene (postman butterfly) hme-miR-965
  11. Manduca sexta mse-miR-965
  12. Tribolium castaneum tca-miR-965-3p