Drosophila mojavensis Dmo-Mir-965_3p (mature (co-guide))

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila mojavensis Dmo-Mir-965_3p (mature (co-guide)) URS00001CA257_7230

22 nucleotides
1 database (MirGeneDB)
Found in 12 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UAAGCGUAUAGCUUUUCCCCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 12 other species

Acyrthosiphon pisum api-miR-965
Bombyx mori (domestic silkworm) bmo-miR-965-3p
Drosophila ananassae Dan-Mir-965_3p (mature (guide))
Drosophila melanogaster (fruit fly) dme-miR-965-3p
Drosophila pseudoobscura dps-miR-965-3p
Drosophila pseudoobscura pseudoobscura (Fruit fly) miRNA FBtr0330777_df_nrg
Drosophila simulans dsi-miR-965-3p
Drosophila yakuba Dya-Mir-965_3p (mature (guide))
Heliconius melpomene (postman butterfly) hme-miR-965
Manduca sexta mse-miR-965
Polistes canadensis pca-miR-965-3p
Tribolium castaneum tca-miR-965-3p