Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-296-5p URS00001C3AC1_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-296: Hsa-mir-296 is a differentially expressed miRNA that has been studied in various contexts [PMC3110257]. It has been found to be downregulated in psoriatic uninvolved skin compared to normal skin [PMC3110257]. In a study on group A, hsa-mir-296 was also found to be downregulated, while several other miRNAs were upregulated [PMC4453619]. Hsa-mir-296 has been identified as one of the downregulated miRNAs in different studies, including those focused on hepatitis C viral replication and angiogenesis [PMC9953690] [PMC7565861] [PMC2887814]. It has also been shown to play a regulatory role in angiogenesis and is influenced by angiogenic factors [PMC2887814]. Hsa-mir-296 is known to target the VEGFA gene and is involved in the VEGF signaling pathway [PMC7955132]. It has also been found to be associated with TMED2/3/4/9 and other related miRNAs in an interaction network analysis [PMC9816852]. The expression levels of hsa-mir-296 have been analyzed using qRT-PCR assays with specific primers and probes [PMC3917617] [PMC4113354]. Inhibition of hsa-mir-296 with antagomirs has shown promising results in reducing angiogenesis in tumor xenografts in vivo [PMC2887814].

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGGCCCCCCCUCAAUCCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

  1. Callithrix jacchus cja-miR-296
  2. Cavia porcellus cpo-miR-296-5p
  3. Macaca mulatta (Rhesus monkey) mml-miR-296-5p
  4. Mus musculus mmu-miR-296-5p
  5. Pongo pygmaeus (Bornean orangutan) ppy-miR-296-5p
  6. Rattus norvegicus (Norway rat) rno-miR-296-5p
Publications