Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-301a-3p URS00001C11BC_10090

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Mus musculus. Annotated by 7 databases (PirBase, RefSeq, TarBase, ENA, LncBase, miRBase, MirGeneDB). Described in 27 papers. Mus musculus (house mouse) mmu-miR-301a-3p sequence is a product of mmu-miR-301a, Mir301, mmu-miR-301a-3p, miR-301a-3p, miR-301a, miR-301 genes. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 0610006A11Rik, 0610007H07Rik, 0610007H10Rik, 0610007I11Rik, 0610009F02Rik, 0610010G05Rik, 0610010H08Rik, 0610010I20Rik, 0610011D08Rik, 0610016J10Rik.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CAGUGCAAUAGUAUUGUCAAAGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 37 other species

    1. Alligator mississippiensis (American alligator) Ami-Mir-130-P2a_3p (mature (guide))
    2. Anolis carolinensis aca-miR-301a-3p
    3. Bos taurus Bta-Mir-130-P2a_3p (mature (guide))
    4. Callithrix jacchus cja-miR-301a
    5. Callorhinchus milii (elephant shark) eshark_mir-130_2
    6. Canis lupus familiaris (dog) cfa-miR-301a
    7. Capra hircus (goat) chi-miR-301a-3p
    8. Cavia porcellus Cpo-Mir-130-P2a_3p (mature (guide))
    9. Cervus elaphus Cel-miR-301a
    10. Chiloscyllium plagiosum microRNA cpl-miR-301
    11. Chrysemys picta bellii (western painted turtle) Cpi-Mir-130-P2a_3p (mature (guide))
    12. Chrysemys picta (Painted turtle) cpi-miR-301a-3p
    13. Columba livia (rock pigeon) Cli-Mir-130-P2a_3p (mature (guide))
    14. Cricetulus griseus cgr-miR-301a-3p
    15. Cyprinus carpio ccr-miR-301a
    16. Danio rerio (zebrafish) Dre-Mir-130-P2a1_3p (mature (guide))
    17. Dasypus novemcinctus (nine-banded armadillo) Dno-Mir-130-P2a_3p (mature (guide))
    18. Echinops telfairi Ete-Mir-130-P2a_3p (mature (guide))
    19. Equus caballus eca-miR-301a
    20. Gallus gallus (chicken) Gga-Mir-130-P2a_3p (mature (guide))
    21. Gorilla gorilla (western gorilla) ggo-miR-301a
    22. Homo sapiens hsa-miR-301a-3p
    23. Ictalurus punctatus ipu-miR-301a
    24. Macaca mulatta (Rhesus monkey) mml-miR-301a-3p
    25. Microcebus murinus mmr-miR-301a
    26. Monodelphis domestica mdo-miR-301-3p
    27. Nomascus leucogenys nle-miR-301a
    28. Ornithorhynchus anatinus (platypus) oan-miR-301-3p
    29. Oryctolagus cuniculus (rabbit) Ocu-Mir-130-P2a_3p (mature (guide))
    30. Otolemur garnettii oga-miR-301a
    31. Pan troglodytes (chimpanzee) ptr-miR-301a
    32. Pongo pygmaeus ppy-miR-301a
    33. Python bivittatus (Burmese python) pbv-miR-301a-3p
    34. Rattus norvegicus (Norway rat) rno-miR-301a-3p
    35. Salmo salar ssa-miR-301d-3p
    36. Scyliorhinus torazame Sto-Mir-130-P2b_3p (mature (co-guide))
    37. Taeniopygia guttata tgu-miR-301-3p
    38. Xenopus tropicalis xtr-miR-301