Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cricetulus griseus (Chinese hamster) cgr-miR-301a-3p URS00001C11BC_10029

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUGCAAUAGUAUUGUCAAAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 30 other species

  1. Anolis carolinensis aca-miR-301a-3p
  2. Callithrix jacchus (white-tufted-ear marmoset) cja-miR-301a
  3. Callorhinchus milii Cmi-Mir-130-P2a_3p (mature (co-guide))
  4. Canis lupus familiaris (dog) cfa-miR-301a
  5. Capra hircus (goat) chi-miR-301a-3p
  6. Cervus elaphus (red deer) Cel-miR-301a
  7. Chiloscyllium plagiosum microRNA cpl-miR-301
  8. Chrysemys picta (Painted turtle) cpi-miR-301a-3p
  9. Cyprinus carpio ccr-miR-301a
  10. Equus caballus eca-miR-301a
  11. Gallus gallus Gallus_gallus piRNA piR-gga-397117
  12. Gekko japonicus Gja-Mir-130-P2b_3p (mature (guide))
  13. Gorilla gorilla gorilla ggo-miR-301a (MIR301A)
  14. Gorilla gorilla (western gorilla) ggo-miR-301a
  15. Homo sapiens (human) hsa-miR-301a-3p
  16. Ictalurus punctatus (channel catfish) ipu-miR-301a
  17. Macaca mulatta mml-miR-301a-3p
  18. Microcebus murinus (gray mouse lemur) mmr-miR-301a
  19. Monodelphis domestica mdo-miR-301-3p
  20. Mus musculus (house mouse) mmu-miR-301a-3p
  21. Nomascus leucogenys nle-miR-301a
  22. Ornithorhynchus anatinus oan-miR-301-3p
  23. Otolemur garnettii (small-eared galago) oga-miR-301a
  24. Pan troglodytes (chimpanzee) ptr-miR-301a
  25. Pongo pygmaeus (Bornean orangutan) ppy-miR-301a
  26. Python bivittatus (Burmese python) pbv-miR-301a-3p
  27. Rattus norvegicus (Norway rat) rno-miR-301a-3p
  28. Salmo salar (Atlantic salmon) ssa-miR-301d-3p
  29. Taeniopygia guttata (zebra finch) tgu-miR-301-3p
  30. Xenopus tropicalis xtr-miR-301
Publications