Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3911 URS00001B968D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3911: Hsa-mir-3911 is a microRNA that has been identified as downregulated under certain treatments and conditions [PMC7226145][PMC8158476][PMC8712139]. It is the only miRNA that is shared between preeclampsia and healthy controls [PMC8158476]. Hsa-mir-3911 has been found to be downregulated in infants with biliary atresia [PMC4754688]. It has also been shown to target the genes PLCB1 and POU2F1 [PMC7854084][PMC4754688]. Hsa-mir-3911 is involved in various pathways, including Proteoglycans in cancer, Rap1 signaling pathway, and Glutamatergic synapse [PMC4754688]. Additionally, hsa-mir-3911 has been identified as a potential biomarker for further validation in certain conditions [PMC4754688].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGUGGAUCCUGGAGGAGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications