v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Anolis carolinensis (green anole) Aca-Mir-19-P2a_5p* (star (passenger)) URS00001B9622_28377

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGUUUUGCAGGUUUGCAUCCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Alligator mississippiensis (American alligator) ami-miR-19b-5p
  2. Bos taurus (domestic cattle) Bta-Mir-19-P2a_5p* (star (passenger))
  3. Callithrix jacchus (white-tufted-ear marmoset) Cja-Mir-19-P2a_5p* (star (passenger))
  4. Canis lupus familiaris (dog) Cfa-Mir-19-P2a_5p* (star (passenger))
  5. Capra hircus (goat) chi-miR-19b-5p
  6. Cavia porcellus (domestic guinea pig) cpo-miR-19b-5p
  7. Chrysemys picta bellii (western painted turtle) Cpi-Mir-19-P2a_5p* (star (passenger))
  8. Columba livia (rock pigeon) cli-miR-19b-5p
  9. Cricetulus griseus cgr-miR-19b-5p
  10. Dasypus novemcinctus dno-miR-19b-5p
  11. Echinops telfairi Ete-Mir-19-P2a_5p* (star (passenger))
  12. Equus caballus (horse) Eca-Mir-19-P2a_5p* (star (passenger))
  13. Gallus gallus (chicken) gga-miR-19b-5p
  14. Gekko japonicus Gja-Mir-19-P2a_5p* (star (passenger))
  15. Homo sapiens hsa-miR-19b-1-5p
  16. Latimeria chalumnae (coelacanth) Lch-Mir-19-P2a_5p* (star (passenger))
  17. Loxodonta africana (African savanna elephant) Laf-Mir-19-P2a_5p* (star (passenger))
  18. Macaca mulatta (Rhesus monkey) Mml-Mir-19-P2a_5p* (star (passenger))
  19. Microcebus murinus (gray mouse lemur) Mmr-Mir-19-P2a_5p* (star (passenger))
  20. Monodelphis domestica (gray short-tailed opossum) mdo-miR-19b-1-5p
  21. Mus musculus (house mouse) mmu-miR-19b-1-5p
  22. Ophiophagus hannah oha-miR-19b-5p
  23. Ornithorhynchus anatinus oan-miR-19b-2-5p
  24. Oryctolagus cuniculus (rabbit) ocu-miR-19b-5p
  25. Pongo abelii (Sumatran orangutan) Pab-Mir-19-P2a_5p* (star (passenger))
  26. Pteropus alecto (black flying fox) pal-miR-19-2-5p
  27. Python bivittatus (Burmese python) Pbv-Mir-19-P2a_5p* (star (passenger))
  28. Rattus norvegicus Rno-Mir-19-P2a_5p* (star (passenger))
  29. Sarcophilus harrisii Sha-Mir-19-P2a_5p* (star (passenger))
  30. Scyliorhinus torazame Sto-Mir-19-P2a_5p* (star (passenger))
  31. Sphenodon punctatus (tuatara) Spt-Mir-19-P2a_5p* (star (passenger))
  32. Taeniopygia guttata tgu-miR-19b-1-5p
  33. Xenopus laevis (African clawed frog) Xla-Mir-19-P2a3_5p* (star (passenger))
 Relationships

Molecular Relationships