Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) Rno-Mir-19-P2a_5p* (star (passenger)) URS00001B9622_10116

  • 23 nucleotides
  • 1 database (MirGeneDB)
  • Found in 15 other species
  • miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUUUUGCAGGUUUGCAUCCAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Alligator mississippiensis ami-miR-19b-5p
  2. Capra hircus chi-miR-19b-5p
  3. Cavia porcellus (domestic guinea pig) cpo-miR-19b-5p
  4. Columba livia (rock pigeon) cli-miR-19b-5p
  5. Cricetulus griseus cgr-miR-19b-5p
  6. Dasypus novemcinctus dno-miR-19b-5p
  7. Gallus gallus gga-miR-19b-5p
  8. Homo sapiens hsa-miR-19b-1-5p
  9. Monodelphis domestica (gray short-tailed opossum) mdo-miR-19b-1-5p
  10. Mus musculus (house mouse) mmu-miR-19b-1-5p
  11. Ophiophagus hannah (king cobra) oha-miR-19b-5p
  12. Ornithorhynchus anatinus (platypus) oan-miR-19b-2-5p
  13. Oryctolagus cuniculus ocu-miR-19b-5p
  14. Pteropus alecto (black flying fox) pal-miR-19-2-5p
  15. Taeniopygia guttata tgu-miR-19b-1-5p