Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-27a-5p URS00001B341F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-27a: Hsa-mir-27a is a microRNA that was identified as upregulated in a study analyzing miRNA expression profiles, where it was one of eight miRNAs found to have increased expression levels [PMC4222092]. This particular microRNA has been implicated in the regulation of genes that may be critical in the pathogenesis of various cancers, as suggested by its altered expression levels in the study [PMC4222092]. However, there is no direct evidence in the provided context linking hsa-mir-27a with overall survival in Asian patients with gastric cancer and non-small cell lung cancer [PMC4586796]. Computational predictions using miRTarG have identified potential target sites for hsa-mir-27a on the 3’-UTR of PIK3CD mRNA, suggesting a possible mechanism through which hsa-mir-27a may exert its effects on cellular pathways by influencing PIK3CD expression [PMC3783482].

mRNA interactions 21 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGGCUUAGCUGCUUGUGAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 17 other species

Relationships

Molecular Relationships

GoFlow Results Publications