Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-27a-5p URS00001B341F_9606

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (TarBase, RefSeq, MirGeneDB, miRBase, MalaCards, LncBase, PSICQUIC, ENA, GeneCards). Described in 72 papers. Homo sapiens (human) hsa-miR-27a-5p sequence is a product of hsa-miR-27a, miR-27a, hsa-miR-27a-5p, miR-27, miR-27a-5p, MIR27A genes. Found in the human reference genome. Interacts with lncRNAs, such as (). Interacts with protein-coding genes, including 1-8D, 1-8U, 11B6, 123F2, 15.5K, 182-FIP, 2A9, 3-10C, 4F2, 4F2HC.

Interactions 42

According to PSICQUIC, Homo sapiens (human) hsa-miR-27a-5p interacts with:

Interaction id Participant Synonyms
URS00001B341F_9606-21 O00257 O00257
URS00001B341F_9606-4 O00257 O00257
URS00001B341F_9606-22 O14733 O14733
URS00001B341F_9606-5 O14733 O14733
URS00001B341F_9606-6 O15455 O15455
URS00001B341F_9606-23 O15455 O15455
URS00001B341F_9606-24 O75144 O75144
URS00001B341F_9606-7 O75144 O75144
URS00001B341F_9606-25 O95999 O95999
URS00001B341F_9606-8 O95999 O95999
URS00001B341F_9606-26 P09429 P09429
URS00001B341F_9606-9 P09429 P09429
URS00001B341F_9606-0 P09601 P09601
URS00001B341F_9606-27 P09601 P09601
URS00001B341F_9606-1 P10415 P10415
URS00001B341F_9606-28 P10415 P10415
URS00001B341F_9606-29 P14778 P14778
URS00001B341F_9606-2 P14778 P14778
URS00001B341F_9606-30 P17676 P17676
URS00001B341F_9606-10 P17676 P17676
URS00001B341F_9606-11 P21580 P21580
URS00001B341F_9606-31 P21580 P21580
URS00001B341F_9606-32 P29459 P29459
URS00001B341F_9606-12 P29459 P29459
URS00001B341F_9606-13 P30793 P30793
URS00001B341F_9606-33 P30793 P30793
URS00001B341F_9606-14 P35251 P35251
URS00001B341F_9606-34 P35251 P35251
URS00001B341F_9606-3 P49238 P49238
URS00001B341F_9606-35 P49238 P49238
URS00001B341F_9606-15 P61088 P61088
URS00001B341F_9606-36 P61088 P61088
URS00001B341F_9606-16 P78423 P78423
URS00001B341F_9606-37 P78423 P78423
URS00001B341F_9606-17 Q03518 Q03518
URS00001B341F_9606-38 Q03518 Q03518
URS00001B341F_9606-39 Q04206 Q04206
URS00001B341F_9606-18 Q04206 Q04206
URS00001B341F_9606-19 Q15025 Q15025
URS00001B341F_9606-40 Q15025 Q15025
URS00001B341F_9606-41 Q86XR7 Q86XR7
URS00001B341F_9606-20 Q86XR7 Q86XR7

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGGGCUUAGCUGCUUGUGAGCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 19 other species