Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-100-3p URS00001A405B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-100: Hsa-mir-100 is a microRNA that has been found to have elevated expression levels, which is associated with a better overall survival prognosis in BRCA [PMC6083503]. Interestingly, hsa-mir-100, along with hsa-miR-99a, targets HS3ST2 [PMC8314594].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAAGCUUGUAUCUAUAGGUAUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Alligator mississippiensis ami-miR-100-3p
  2. Chrysemys picta (Painted turtle) cpi-miR-100-3p
  3. Columba livia (rock pigeon) cli-miR-100-3p
  4. Python bivittatus (Burmese python) pbv-miR-100-3p
Publications